Translate

Sequence Manipulation Suite:

Translate

Translate accepts a DNA sequence and converts it into a protein in the reading frame you specify. Translate supports the entire IUPAC alphabet and several genetic codes.

Paste a raw sequence or one or more FASTA sequences into the text area below. Input limit is 200,000,000 characters.
>sample sequence gckugcgaygartty >sample sequence 2 ggwgggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc

• Translate in reading frame 1 reading frame 2 reading frame 3 uppercase frame on the direct reverse strand.
• Use the standard (1) vertebrate mitochondrial (2) yeast mitochondrial (3) mold mitochondrial (4) invertebrate mitochondrial (5) ciliate nuclear (6) echinoderm mitochondrial (9) euplotid nuclear (10) bacterial (11) alternative yeast nuclear (12) ascidian mitochondrial (13) flatworm mitochondrial (14) Blepharisma macronuclear (15) chlorophycean mitochondrial (16) trematode mitochondrial (21) Scenedesmus obliquus mitochondrial (22) Thraustochytrium mitochondrial (23) genetic code.

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:08 2023

Valid XHTML 1.0; Valid CSS