Restriction Map

Sequence Manipulation Suite:

Restriction Map

Restriction Map accepts a DNA sequence and returns a textual map showing the positions of restriction endonuclease cut sites. The translation of the DNA sequence is also given, in the reading frame you specify. Use the output of this program as a reference when planning cloning strategies. Restriction Map supports the entire IUPAC alphabet and several genetic codes.

Paste a raw sequence or one or more FASTA sequences into the text area below. Input limit is 100,000,000 characters.
>sample sequence cagctggggggaggtggcgaggaagatgacgtggtagttgtcgcggcagctgccaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatcacctgctacttctcccgccacctccc

• Show 105 90 75 60 45 30 bases per line.
• Show the translation for reading frame 1 2 3 1, 2, and 3 uppercase text none
• Use the standard (1) vertebrate mitochondrial (2) yeast mitochondrial (3) mold mitochondrial (4) invertebrate mitochondrial (5) ciliate nuclear (6) echinoderm mitochondrial (9) euplotid nuclear (10) bacterial (11) alternative yeast nuclear (12) ascidian mitochondrial (13) flatworm mitochondrial (14) Blepharisma macronuclear (15) chlorophycean mitochondrial (16) trematode mitochondrial (21) Scenedesmus obliquus mitochondrial (22) Thraustochytrium mitochondrial (23) genetic code.
• Treat sequences as linear circular molecules.
• Generate color black and white output.

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:07 2023

Valid XHTML 1.0; Valid CSS