Codon Usage

Sequence Manipulation Suite:

Codon Usage

Codon Usage accepts one or more DNA sequences and returns the number and frequency of each codon type. Since the program also compares the frequencies of codons that code for the same amino acid (synonymous codons), you can use it to assess whether a sequence shows a preference for particular synonymous codons.

Paste the raw sequence or one or more FASTA sequences into the text area. Input limit is 500,000,000 characters.
>sample sequence one atgtttcagaaagaggatcttgctacatggatgcaaatttcaatgagtggtcaatttgatgatacagcattagaggaatggagtacaaatggtaaagaacctgagatctgtgagaaatctccaaaagctgatggagttactacgattatggagagagctctatgtccatgggatagcagagtcaactaccaagagagccgagaacctaaattgattgctgaatcagtttgtctatgccgtaagagccgtggttctacaggagctttctgtatgccaattgttcgaaaagttccaattctccgacgtgtctcttgtgatcgttcaacaggtttatggaattatgtaagatcaactgagctaataactgttggatgtcattctgtattgccaagaactcaaagagcagcacgtcttgcccatttatcatcttctcgtattattgtttaa >sample sequence two caggttacaattggagccatttcatcttctgactgaggaaatcaggtccgacagcgtagatgtatacacgctctattcacaaaattggtaacgattctg

• Use the standard (1) vertebrate mitochondrial (2) yeast mitochondrial (3) mold mitochondrial (4) invertebrate mitochondrial (5) ciliate nuclear (6) echinoderm mitochondrial (9) euplotid nuclear (10) bacterial (11) alternative yeast nuclear (12) ascidian mitochondrial (13) flatworm mitochondrial (14) Blepharisma macronuclear (15) chlorophycean mitochondrial (16) trematode mitochondrial (21) Scenedesmus obliquus mitochondrial (22) Thraustochytrium mitochondrial (23) genetic code.

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:06 2023

Valid XHTML 1.0; Valid CSS