DNA Pattern Find

Sequence Manipulation Suite:

DNA Pattern Find

DNA Pattern Find accepts one or more sequences along with a search pattern and returns the number and positions of sites that match the pattern. Use DNA Pattern Find to locate sequence regions that match a consensus sequence of interest.

Paste a raw sequence or one or more FASTA sequences into the text area below. White space and digits are removed before the pattern matching is performed. Input limit is 500,000,000 characters.
>sample sequence one ttaaggaccccatgccctcgaataggcttgagcttgccaattaacgcgcacgggctggccgggcgtataagccaaggtgtagtgaggttgcattatacatgccggcttgtgattaacgcatgccataggacggttaggctcagaacccgcaaccaatacacgtgattttctcgtcccctg >sample sequence two aggcgtatgcgatcctgaccatgcaaaactccagcgtaaatacctagccatggcgacacaaggcgcaagacaggagatgacggcgtttagatcggcgaaatattaaagcaaacgacgatgacttcttcgggaaattagttccctactcgtgtactccaattagccataacactgttcgtcaagatatagggggtcacccatgaatgtcctctaaccagaccatttcgttacacgaacgtatct >sample sequence three tactcagggctccagaggtacaagttggtaatcggttaggtgtatcgccgccaggggtgcgtcgtcatgactcggttaga
Enter the search pattern to be used. The default pattern "ctt[ca]" searches for occurrences of "cttc" and "ctta".

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:06 2023

Valid XHTML 1.0; Valid CSS