Pairwise Align DNA

Sequence Manipulation Suite:

Pairwise Align DNA

Pairwise Align DNA accepts two DNA sequences and determines the optimal global alignment. Use Pairwise Align DNA to look for conserved sequence regions.

Paste sequence one (in raw sequence or FASTA format) into the text area below. Input limit is 20,000 characters.
>sequence one gcgcgtgcgcggaaggagccaaggtgaagttgtagcagtgtgtcagaagaggtgcgtggc accatgctgtcccccgaggcggagcgggtgctgcggtacctggtcgaagtagaggagttg
Paste sequence two (in raw sequence or FASTA format) into the text area below. Input limit is 20,000 characters.
>sequence two gacttgtggaacctacttcctgaaaataaccttctgtcctccgagctctccgcacccgtg gatgacctgctcccgtacacagatgttgccacctggctggatgaatgtccgaatgaagcg

Use the following parameters to specify how alignments are scored.

• Match value 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Mismatch value 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Value for gaps preceding a sequence 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Value for internal gaps 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Value for gaps following a sequence 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:07 2023

Valid XHTML 1.0; Valid CSS