Primer Map

Sequence Manipulation Suite:

Primer Map

Primer Map accepts a DNA sequence and returns a textual map showing the annealing positions of PCR primers. Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. Primer Map supports the entire IUPAC alphabet and several genetic codes.

Paste a raw sequence or one or more FASTA sequences into the text area below. Input limit is 200,000,000 characters.
>sample sequence cagctggggggaggtggcgaggaagatgacgtggtcgaggtcgacggtatcgagttgtcgcggcagctgccaatacgactcactatagaggagaagtagcaagaaaaataacatgataattatcacgacaactacctggtgatgttgctagtaatattacttgttatttttctcgtcatcttcccggcgacgtcgccagcaacatctttagtgagggttaatcacctgctacttctcccgccacctccc
Enter the primers you want to display. An example primer entry is: (T7) aatacgactcactatag. The round brackets surround the name of the primer, and the sequence is written in the 5' to 3' direction. Multiple entries are separated by commas.
(reverse) aacagctatgaccatg, (T3) attaaccctcactaaag, (KS) cgaggtcgacggtatcg, (SK) tctagaactagtggatc, (T7) aatacgactcactatag, (-40) gttttcccagtcacgac, (Sp6) atttaggtgacactatag, (M13 for) gtaaaacgacggccagt, (M13 rev) cacacaggaaacagctatgaccat, (BGH rev) tagaaggcacagtcgagg, (pGEX for) ctggcaagccacgtttggtg, (pGEX rev) ggagctgcatgtgtcagagg, (T7-EEV aaggctagagtacttaatacga, (pUC/M13 Forward) gttttcccagtcacgac, (pUC/M13 forward) cgccagggttttcccagtcacgac, (pUC/M13 reverse) caggaaacagctatgac, (pUC/M13 reverse) tcacacaggaaacagctatgac, (Glprimer1) tgtatcttatggtactgtaactg, (GLprimer2) ctttatgtttttggcgtcttcca, (RVprimer3) ctagcaaaataggctgtccc, (RVprimer4) gacgatagtcatgccccgcg, (Lambda gt11 Forward) ggtggcgacgactcctggagcccg, (Lambda gt11 Reverse) ttgacaccagaccaactggtaatg, (Lambda gt10 Forward) cttttgagcaagttcagcctggttaag, (lambda gt10 Reverse) gaggtggcttatgagtatttcttccagggta, (Pinpoint Sequencing) cgtgacgcggtgcagggcg, (pTarget Sequencing) ttacgccaagttatttaggtgaca

• Show 105 90 75 60 45 30 bases per line.
• Show the translation for reading frame 1 2 3 1, 2, and 3 uppercase text none
• Use the standard (1) vertebrate mitochondrial (2) yeast mitochondrial (3) mold mitochondrial (4) invertebrate mitochondrial (5) ciliate nuclear (6) echinoderm mitochondrial (9) euplotid nuclear (10) bacterial (11) alternative yeast nuclear (12) ascidian mitochondrial (13) flatworm mitochondrial (14) Blepharisma macronuclear (15) chlorophycean mitochondrial (16) trematode mitochondrial (21) Scenedesmus obliquus mitochondrial (22) Thraustochytrium mitochondrial (23) genetic code.
• Restriction sites should be shown not be shown
• Treat sequences as linear circular molecules.
• Generate color black and white output.

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:07 2023

Valid XHTML 1.0; Valid CSS