Pairwise Align Codons

Sequence Manipulation Suite:

Pairwise Align Codons

Pairwise Align Codons accepts two coding sequences and determines the optimal global alignment. The scoring matrix used to calculate the alignment is described in Schneider et al. (2005). Use Pairwise Align Codons to look for conserved coding sequence regions. Only the bases A,C,G,T and U are used in the alignment.

Paste sequence one (in raw sequence or FASTA format) into the text area below. Input limit is 6,000,000 characters.
>sequence one atgtttcagaaagaggatcttgctacatggatgcaaatttcaatgagtggtcaatttgatgatacagcattagaggaatggagtacaaatggtaaagaacctgagatctgtgagaaatctccaaaagctgatggagttactacgattatggagagagctctatgtccatgggatagcagagtcaactaccaagagagccgagaacctaaattgattgctgaatcagtttgtctatgccgtaagagccgtggttctacaggagctttctgtatgccaattgttcgaaaagttccaattctccgacgtgtctcttgtgatcgttcaacaggtttatggaattatgtaagatcaactgagctaataactgttggatgtcattctgtattgccaagaactcaaagagcagcacgtcttgcccatttatcatcttctcgtattattgtttaa
Paste sequence two (in raw sequence or FASTA format) into the text area below. Input limit is 6,000,000 characters.
>sequence two caggttacaattggagccatttcatcttctgactgaggaaatcaggtccgacagcgtagatgtatacacgctctattcacaaaattggtaacgattctg

Use the following parameters to specify how alignments are scored.

• Value for gaps preceding a sequence 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Value for internal gaps 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6
• Value for gaps following a sequence 6 5 4 3 2 1 0 -1 -2 -3 -4 -5 -6

*This page requires JavaScript. See browser compatibility.
*You can mirror this page or use it off-line.

Sun 1 Oct 12:00:07 2023

Valid XHTML 1.0; Valid CSS