Skip to content

Navigation Menu

Sign in
Sign up

Repository files navigation

primerblast-oss

Release CI Benchmark License: MIT Python

English | 日本語

A local, open-source, Primer-BLAST-style command-line tool for plant breeding and genetics. It designs PCR primers with Primer3 and verifies their specificity entirely offline against local BLAST+ databases — including unpublished genomes and several cultivars at once — and adds in-silico PCR, whole-region tiling, SNP-under-primer detection, amplicon conservation analysis, CAPS/dCAPS marker design, and an experimenter-facing risk score.

The core is pure Python (standard library only) and calls out to primer3_core and BLAST+. The unit tests require no external tools or data.

Why local and open source

NCBI Primer-BLAST is excellent, but it is not open source and exists only as a hosted web service. You therefore cannot audit, fork, or self-host it, cannot run it next to your data, and cannot submit unpublished or embargoed genomes to it.

Depending on an external service also binds a pipeline to that service's availability and policies — rate limits, maintenance windows, occasional outages. Running the workflow locally and offline removes that dependency and makes a run fully reproducible: pinned FASTA, GFF3, VCF, BLAST database, and tool versions, with no queue and no login. This matters most in precisely the case the hosted tool cannot serve: local, unpublished, multi-cultivar genomes.

primerblast-oss is MIT-licensed, so anyone can read, run, and build on it.

Why this exists

NCBI Primer-BLAST performs two steps: (1) Primer3 designs candidate primers, and (2) BLAST screens each primer against a database and pairs the hits into predicted amplicons, flagging unintended PCR products. Most local "primer + BLAST" scripts perform only the per-primer BLAST and omit step (2) — the step that actually detects off-target products.

primerblast-oss is an independent implementation of step (2) — using a BLAST-alignment-based priming model, not NCBI's exact algorithm — with a focus on things a local, breeding-oriented workflow needs:

NCBI Primer-BLAST PrimerServer2 primerblast-oss
Primer3 design
Pairs BLAST hits into predicted amplicons
Off-target products from either primer as F/F, R/R, F/R
3'-end-aware priming model ✅ (--use-3-end)
Runs offline on unpublished / local genomes hard
Thermodynamic off-target scoring (Tm-based) ✅ (core model) optional (primer3-py)
Multiplex primer-dimer checking of a pool
Multiplex compatible-set design (one pair/target)
Screen against multiple databases in one run partial
In-silico PCR from pasted primers (orientation-free)
Tile a whole region with overlapping amplicons
Gel-resolvability of off-targets (size-gap aware)
Breeding assay: GFF3/VCF/CAPS/QTL + risk
Scriptable CLI + library, no queue/login limited
Curated, continuously-updated databases
Mature hosted web server local GUI only

This is about fit for a local, offline workflow, not a claim of being better overall. NCBI Primer-BLAST has real advantages this tool does not: curated, continuously updated databases, a mature thermodynamic model, and deeper primer-dimer / hairpin analysis. PrimerServer2 is also a strong local tool and shares much of the core recipe; primerblast-oss's additions over it are whole-region tiling, gel-resolvability, one-run multi-database screening, the breeding assay (GFF3/VCF/CAPS/QTL/risk), and multiplex-set design rather than only dimer checking. A ✅ in more than one column means the capability exists on each side — not that the underlying models are identical or that outputs will match.

Benchmarks (summary): across 40 randomly-placed Arabidopsis TAIR10 loci, primerblast-oss and PrimerServer2 predict the same amplicon set (count, size, coordinates) on 92 % of non-repetitive loci; three hand-checked Lotus japonicus pairs matched PrimerServer2 exactly; and across six loci run against the live NCBI Primer-BLAST service, primerblast-oss stays within the NCBI / PrimerServer2 range on every one — matching NCBI in rejecting a non-3'-anchored off-target that PrimerServer2 keeps. Full method, numbers, and an analysis of the residual disagreements are in benchmarks/RESULTS.md §7–§9.

Validation status

The short-term goal is to be a superset of PrimerServer2 for local, scriptable primer work: matching its specificity behaviour on local genomes while adding multi-database screening, tiling, marker design, breeding-assay outputs, and offline reproducibility. The evidence to date:

  • PrimerServer2, 40-locus automated head-to-head (Arabidopsis TAIR10). With matched parameters, the two tools agree on the exact predicted amplicon set for 33 / 36 (92 %) non-repetitive loci. Every residual disagreement is accounted for: repetitive loci where both tools call the primer non-specific but enumerate repeat copies differently, and marginal sites where a primer's 3' end is not fully aligned — which primerblast-oss rejects as non-priming and PrimerServer2 keeps on duplex Tm. None trace to an implementation error (benchmarks/RESULTS.md §9).
  • PrimerServer2, Lotus japonicus. Three hand-checked pairs matched exactly on amplicon count, size, and coordinates (§7).
  • NCBI Primer-BLAST (six loci). Six pairs were run through the live NCBI service and both local tools. All three agree exactly on the three clean loci; on the three borderline loci primerblast-oss sits within the NCBI / PrimerServer2 range — on one it matches NCBI in rejecting an off-target that PrimerServer2 keeps (a non-3'-anchored site), on another it matches PrimerServer2. Every difference is a single borderline product near a Tm or 3'-alignment threshold, not an error (§8b). Still a modest sample, and NCBI screens its own Arabidopsis assembly rather than the local FASTA.
  • Continuous regression benchmark. CI builds a synthetic FASTA/BLAST database and exercises Primer3 design, BLAST amplicon pairing, duplicate/off-target classification, thermodynamic gating, and multiplex dimer checks on every push.
  • Wet-lab validation panel. A versioned panel (validation_panel/) records prospective experimental outcomes (protocol metadata, observed bands, exclusion provenance) against immutable in-silico predictions, and benchmarks/validation_analysis.py reports off-target sensitivity / false-positive rate, amplification failure, rank/risk calibration, and CAPS digest concordance. Until real assays are recorded, the panel is defined but uncalibrated (validation_panel/RESULTS.md).

Against NCBI Primer-BLAST, no claim of drop-in equivalence is made: NCBI retains the advantage in curated, continuously-updated databases, hosted UX, and a private, long-matured specificity model. primerblast-oss is the stronger choice when the data that matter are local, unpublished, multi-reference, or must run reproducibly in scripts.

How specificity is judged

For each primer pair and each database:

  1. blastn -task blastn-short finds every near-full-length hit of each primer.
  2. A hit becomes a priming site only if the primer's 3' end is aligned, its 3'-terminal base matches, mismatches within the 3' window (--three-prime-window, default 5) are ≤ --max-3prime-mismatch (default 1), and total mismatches over the full primer are ≤ --max-total-mismatch (default 4). Unaligned 5' bases count as mismatches.
  3. On each subject, a plus-strand priming site is paired with every downstream minus-strand priming site within the product-size window (--min-product..--max-product). The product span is measured 5'→5' (true PCR amplicon length).
  4. A product is on-target if both primers anneal perfectly (0 mismatch), in F/R orientation, at the designed size (± --size-tolerance). Everything else is off-target. A pair is specific when exactly one product (the intended one) is predicted in every screened database.

Pairs are scored and ranked A–D by specificity, Tm balance, GC, and 3'-dimer strength.

Use --specificity-profile ncbi to switch the mismatch thresholds to a NCBI-Primer-BLAST-like stringency profile: up to 5 total mismatches are kept as candidate priming sites, up to 1 mismatch is allowed within the 3'-terminal 5 bp, and a terminal-base mismatch is counted rather than rejected outright. This is a compatibility profile for threshold behavior; it is still not NCBI's private algorithm or database.

Requirements

  • Python ≥ 3.8 (standard library only)
  • primer3_core (Debian/Ubuntu: apt install primer3)
  • BLAST+ blastn / makeblastdb (apt install ncbi-blast+)
  • A nucleotide BLAST database (see below)

Install

pip install -e . # provides the `primerblast-oss` command
pip install -e '.[thermo]' # + optional primer3-py (thermodynamics & dimers)
# or run without installing:
python -m primerblast_oss --help

Both primerblast-oss <subcommand> (after install) and python -m primerblast_oss <subcommand> are equivalent; this README uses the python -m form so the examples work without installing.

Quick start

# 1. build a BLAST database from a genome FASTA (once)
python -m primerblast_oss makedb genome.fa --out-db mydb
# 2. design primers on a template and check them against that genome
python -m primerblast_oss design \
 --template-fasta my_gene.fa --product-size 150-500 --db mydb
# 3. or just in-silico-PCR a pair you already have
python -m primerblast_oss check \
 --forward GACAAGGAATCAGCGGCTCT --reverse GCAGCGTTTTGTAGTGGGTG --db mydb

A local browser GUI wrapping these subcommands also exists, but it is an optional extra — see Web GUI (optional) near the end.

Usage

primerblast-oss is a CLI tool. Subcommands: design, check, multiplex, multiplex-design, tile, assay, markers, makedb. Run python -m primerblast_oss <subcommand> --help for the full option list of any one.

multiplex checks primer-dimer compatibility across a pool of primers (needs primer3-py) — every primer against every other, to pick sets you can run together:

python -m primerblast_oss multiplex \
 --primer A_F=... --primer A_R=... --primer B_F=... --primer B_R=...

multiplex-design goes a step further: give it several targets (a multi-record template FASTA) and it designs candidates for each, then picks one mutually-compatible pair per target so no two primers form a concerning cross-dimer. NCBI Primer-BLAST designs each amplicon independently and cannot do this.

python -m primerblast_oss multiplex-design \
 --template-fasta targets.fa --db $DB --genome-fasta genome.fa \
 --product-size 80-300 --candidates-per-target 5 --require-specific

design — region + product size → primer pairs

python -m primerblast_oss design \
 --template-fasta my_gene.fa \
 --db /path/to/genome_db \
 --product-size 150-500 --format text

Screen against several cultivar genomes at once (specific in all of them):

python -m primerblast_oss design \
 --template "ACGT..." --template-id MyLocus \
 --db /data/blastdb/cultivarA --db /data/blastdb/cultivarB \
 --product-size 200-800 --format tsv

check — primer sequences → all predicted PCR products (in-silico PCR)

Paste primers; orientation is not constrained (any primer may act as forward or reverse). Every product is listed with its size and the size gap to the nearest other product, so you can judge whether extra bands are resolvable.

python -m primerblast_oss check \
 --forward GCACTCTAGAGGTTCAAGGCC --reverse TGGTACGTGTGGTTCAGTTTCA \
 --db /path/to/genome_db
# or a pool of primers by name:
python -m primerblast_oss check \
 --primer F1=ACGT... --primer F2=TTGC... --primer R1=GGCA... \
 --db /path/to/genome_db --format json

tile — region + amplicon length → overlapping amplicons covering the whole region

Primer-BLAST designs one amplicon around a target; tile instead walks the entire region with overlapping amplicons (e.g. to sequence a whole gene).

python -m primerblast_oss tile \
 --template-fasta gene.fa \
 --amplicon-min 400 --amplicon-max 700 --overlap 60 \
 --db /path/to/genome_db

assay — full breeding assay from a gene / interval / SNP

Resolves a target from a local genome + GFF3/VCF, designs primers, checks specificity across several reference genomes, flags SNPs under primers, scores amplicon conservation, runs an optional CAPS/dCAPS enzyme scan, and assigns an experimenter risk (low/medium/high). Outputs text, JSON, CSV, BED, an oligo order table, or a self-contained HTML report.

DB=/path/to/blastdb
# a gene, screened across three cultivars, with a VCF and CDS feature
python -m primerblast_oss assay \
 --gene Psat.cameor.v2.1g00050 --gene-feature cds --gff3 genome.gff3 \
 --genome genome.fa \
 --db $DB/cameor_v2 --db $DB/unpublished_cultivar --db $DB/ZW6 \
 --vcf variants.vcf --flank 100 --product-size 150-600 --format html --out report.html
# a CAPS marker spanning a SNP (alt allele given)
python -m primerblast_oss assay --snp chr1:6385 --alt A \
 --genome genome.fa --db $DB/cameor_v2 --flank 250 --format text

markers — evenly spaced markers across a QTL interval

python -m primerblast_oss markers --interval chr1:80000000-90000000 \
 --genome genome.fa --db $DB/cameor_v2 --n-markers 20 --format json

makedb — build a database (with -parse_seqids)

python -m primerblast_oss makedb genome.fa --out-db genome_db

How it approaches NCBI Primer-BLAST's common pain points

These are the pain points the tool is designed around. Coverage varies and some items are partial — see Limitations.

# Common pain point primerblast-oss approach
1 weak at batch / many regions markers, assay over BED/gene lists; CLI + library, scriptable
2 poor fit for local / custom assemblies everything runs on local FASTA + BLAST DB; makedb helper
3 weak multi-reference comparison --db repeatable; amplicon conservation scored per reference
4 whole-chromosome design is clumsy tile + markers generate primers across whole regions/intervals
5 primer strand/orientation unclear every binding site reports strand, 5'/3' coords, extension direction
6 unexpected side products hard to read BLAST hits paired into predicted amplicons with sizes
7 F-F / R-R products hard to see enumerated explicitly and shown in the ASCII map & tables
8 3'-end mismatch not visible explicit 3'-terminal 5 bp / 10 bp mismatch counts per hit
9 paralogs / repeats / duplications genome-wide pairing surfaces duplicated priming sites (no dedicated repeat mask; bounded by BLAST -max_target_seqs)
10 not built for CAPS/dCAPS caps scan: enzymes that digest two alleles differently, gel gap
11 weak GFF3 / VCF / QTL integration --gene/--gff3, --vcf, --interval, BED input
12 opaque empty results Primer3 explain string surfaced; per-stage diagnostics
13 weak reproducibility provenance manifest pins tool versions, params, DB fingerprints
14 weak experimenter-facing scoring risk rolls up every signal into low/medium/high with reasons
15 side products not visualized ASCII off-target map + BED track for a genome browser

Design cues were taken from PrimerServer2 (strand-aware BLAST-hit pairing, multi-threaded blastn, coordinate input) and NCBI Primer-BLAST.

Limitations

Honest scope, so you know what it does not do:

  • Only spot-checked against NCBI Primer-BLAST. It is an independent implementation. One published-Arabidopsis locus matched NCBI exactly (same top pair, same specificity verdict — benchmarks/RESULTS.md §8), but that is a single locus, not systematic validation; results elsewhere are plausible and internally checked, not guaranteed to match NCBI's output.
  • Thermodynamic scoring is optional (needs pip install primer3-py). When a --genome-fasta is supplied (automatic in assay), each site gets a duplex Tm and 3'-end ΔG via primer3 and thermodynamically non-viable sites are gated out; without it, priming falls back to the BLAST-alignment mismatch / 3'-anchor rule.
  • Off-target discovery is bounded by BLAST -max_target_seqs (default 5000). In extremely repetitive regions some hits can be missed; there is no dedicated repeat mask.
  • dCAPS support is best-effort and CAPS calls depend on the enzyme table (~40 common enzymes), not an exhaustive REBASE set.
  • Batch/QTL modes work but are not benchmarked at large scale; each pair costs a BLAST search, so wide sweeps are IO/CPU bound.
  • primer-dimer / hairpin analysis needs primer3-py (optional). With it, each pair gets hairpin / self-dimer / cross-dimer scoring and the multiplex subcommand checks a whole pool; without it, only Primer3's design-time limits apply.

Contributions toward any of these are welcome.

Key options (shared by design/check/tile)

Option Meaning Default
--product-size (design) one or more ranges, e.g. 150-500,500-1000 70-1000
--amplicon-min/--amplicon-max/--overlap (tile) tiling geometry 400/800/40
--opt-tm/--min-tm/--max-tm primer melting temperature window 60/57/63
--specificity-profile mismatch preset: local-strict or ncbi local-strict
--max-total-mismatch mismatches allowed for an off-target to still prime 4
--max-3prime-mismatch mismatches allowed in the 3' window 1
--three-prime-window size of the 3' window 5
--max-product largest off-target amplicon considered amplifiable 4000
--max-target-seqs BLAST hit cap; raise for repetitive genomes 5000
--exhaustive convenience mode using a higher BLAST hit cap off
--num-threads blastn worker threads 4
--high-copy-hit-threshold raw BLAST HSP count that triggers a repeat-sensitivity warning 10000
--gel-min-gap size gap (bp) to resolve two products on a gel 50
--no-3prime-terminal allow a mismatched 3' terminal base off
--genome-fasta enable primer3-py thermodynamic site scoring for design/check/tile off
--min-anneal-tm / --max-3p-dg thermodynamic off-target gate thresholds 40 / -5
--dimer-dg-warn / --dimer-tm-warn primer-dimer/hairpin warning thresholds for assay/multiplex -8 / 45
--format text | json | tsv (design only) text

Verdicts & scoring

Design/tile rank pairs A–D: A = single product in every database; B = extra products but all far enough in size to resolve on a gel; C/D = one or more off-targets that co-migrate with the intended band. Co-migrating off-targets are penalized heavily; size-resolvable ones only lightly — matching how such pairs are used in practice.

JSON output (scripting-friendly)

--format json emits a stable schema for piping into other tools (or a GUI). Every object carries what a consumer needs without recomputation:

  • primer: forward/reverse, tm_f/tm_r, gc_f/gc_r, left_start/ right_start (0-based template positions), product_size, penalty.
  • product (design/check): subject, start, end, size, orientation (e.g. F/R, R/R), fwd_mismatch+rev_mismatch, nearest_gap (bp to the closest other product — drives gel-resolvability shading).
  • pair verdict: rank, score, specific_all_db, gel_distinguishable, total_on_target/total_off_target/total_comigrating, and per_db breakdown.
  • tile: index, covers [start,end], gap_to_prev (overlap>0 / gap<0), plus the full pair object — enough to draw the amplicon track over the region.

Library API

from primerblast_oss import run_pipeline, in_silico_pcr, design_tiling
# design + specificity
result = run_pipeline("MyLocus", template_seq, ["/data/db/genome"])
for pair in result.pairs:
 print(pair.forward, pair.reverse, pair.specificity["rank"])
# in-silico PCR from arbitrary primers
res = in_silico_pcr({"F": "ACGT...", "R": "TTGC..."}, "/data/db/genome")
for a in res["products"]:
 print(a.size, a.subject, a.orientation)
# tile a whole region
tiles = design_tiling("gene", template_seq, ["/data/db/genome"],
 amplicon_min=400, amplicon_max=700, overlap=60)

Web GUI (optional)

The CLI is the primary interface. As a convenience, a local browser front end wraps every subcommand — no cloud, no third-party Python dependencies (it is built on the standard-library http.server). It is an extra, not the main tool. Run it on the machine where primer3_core, blastn, and your BLAST databases live (e.g. inside WSL):

python -m primerblast_oss.webapp # serves http://127.0.0.1:8799, opens a browser
python -m primerblast_oss.webapp --port 9000 --no-browser

It exposes tabs for design / in-silico PCR / tiling / assay / QTL markers / build DB, auto-discovers BLAST databases under ~/.codex/blast_databases, ~/blast_databases and ./databases, runs each job in a background thread, and offers one-click TSV/CSV/BED/JSON downloads. English / 日本語 toggle in the header. It binds to loopback (127.0.0.1) only; on WSL2 Windows browsers reach it via the default localhost forwarding. Everything it does is also available from the CLI.

Tests

Unit tests are pure Python and need no external tools or data:

pip install -e ".[dev]"
pytest # or run the files directly:
python tests/test_specificity.py # specificity / amplicon pairing
python tests/test_integration.py # variants, conservation, risk, CAPS

Benchmark

benchmarks/run_benchmark.py extracts a real region from an .fai-indexed genome, designs primers, and screens specificity — reporting timing and the number of predicted products per pair. Point it at your own data with export PBO_DBDIR=/path/to/blastdb. Real runs on a pea genome (design, multi-cultivar, in-silico PCR, tiling, full assay, CAPS) are written up in benchmarks/RESULTS.md.

benchmarks/head_to_head_ps2.py is the automated concordance benchmark against PrimerServer2: it designs a pair in each of N windows across a genome and compares both tools' predicted amplicons under matched parameters (see benchmarks/RESULTS.md §9).

python benchmarks/head_to_head_ps2.py --genome tair10.fa --db tair10.fa \
 --primertool /path/to/primertool --n-loci 40 --out h2h.json

benchmarks/continuous_benchmark.py is the CI-friendly regression benchmark: it builds a tiny synthetic FASTA/BLAST database and exercises Primer3 design, BLAST amplicon pairing, duplicate/off-target classification, optional thermodynamic gating, and multiplex dimer checks.

python benchmarks/continuous_benchmark.py --max-seconds 30

Contributing

Contributions welcome — see CONTRIBUTING.md. Changes are tracked in CHANGELOG.md.

Citation

If you use this in research, please cite it (see CITATION.cff).

License

MIT © primerblast-oss contributors

About

Local, open-source Primer-BLAST for plant breeding: Primer3 + BLAST+, multi-reference specificity, in-silico PCR, CAPS/dCAPS, offline

Topics

Resources

Contributing

Stars

1 star

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages

AltStyle によって変換されたページ (->オリジナル) /