CutSeq is a library-aware wrapper for cutadapt. Real NGS libraries need several trimming steps performed in the correct order — encoding them all in one cutadapt command is error-prone, and chaining separate commands wastes I/O. CutSeq fixes this with a single input: what the library looks like. It compiles your library scheme into one native cutadapt pass and runs it automatically.
Take SMARTer® Stranded Total RNA-Seq Kit v3 (built-in TAKARAV3) — many
operations in one pass:
| Read | Steps |
|---|---|
| R1 | remove the 5′ p5 adapter + 3-nt linker mask · capture the 8-nt UMI & mask the 6-nt linker at the 3′ end (the 14-nt run-over when insert < read) · remove the 3′ read-through adapter · quality trim |
| R2 | remove the 5′ read-through adapter · extract the 8-nt UMI into the read name · mask the 6-nt linker right after it · remove the 3′ read-through adapter · quality trim |
pip install cutseq
Express the whole library as one scheme and let CutSeq do the rest:
# built-in scheme cutseq -A TAKARAV3 test_R1.fq.gz test_R2.fq.gz # or a custom grammar scheme cutseq -A "ACACGACGCTCTTCCGATCTXXX-XXXXXXNNNNNNNNAGATCGGAAGAGCACACGTC"
The scheme is a top-strand molecular map: one DNA strand, 5′ → 3′, no spaces:
- The part left of the insert marker (
+-:) is read by R1 as-is; the part right of it is the molecule's 3′ continuation and is matched on R2 as its reverse complement automatically (e.g. a right-handAGATCGGAAGAGCACACGTCis matched on R2 asGACGTGTGCTCTTCCGATCT). += sense,-= antisense,:= unstranded.- Uppercase
ACGT...= adapters/primers, trimmed. N= random UMI, captured into the read name (NNNNNNNN/N8).X= masked sequence, trimmed but not captured (XXXXXX/X6).- Lowercase
acgt...= inline barcode, matched and captured. - Homopolymer tails use the dot form
AAA...AAA/TTT...TTT/GGG...GGG; the 5′/3′ direction is auto-detected from the scheme layout (a run at the read start trims the 5′, elsewhere the 3′), andG<k>sets the minimum run length (e.g.G10). - A 3′ read-through adapter (from the other read's 5′ arm) is trimmed automatically from the opposite end of each read.
- Numeric shorthand (
N8,X6) equals the expanded run form.
Captured UMIs/barcodes are appended to the read name with _ by default
(@READID_CTATTAAAAA, exactly like legacy output). Use --rename for full
control — cutadapt's brace variables ({id}, {header}, {cut_prefix},
{match_sequence}, {rc}, ...) plus positional captures {1}, {2}, ...
in scheme order:
cutseq -A INLINE --rename '{id}_BC1:{1}_BC2:{2}_umi:rc({3})' in_R1.fq.gz in_R2.fq.gzTransform functions wrap any capture and nest (case-insensitive):
rc(x)/rev(x)/comp(x)— reverse complement / reverse / complementupper(x),lower(x),len(x)canon(x)— canonical UMI,min(x, rc(x)), for UMI collapsingleft(x,k),right(x,k),slice(x,a,b)— substring helpers
In paired mode {r1.1} / {r2.1} force a specific read; an unprefixed capture
resolves to its anchor read (left-side captures → R1, right-side → R2), so
both mates carry the same value. Without --rename, output is byte-for-byte
legacy-compatible.
Spatial libraries stack several fixed-length barcodes on one arm. In
DBiT-seq (deterministic barcoding in tissue, ×ばつ50 grid) R2 walks
handle(22) | BarcodeB(8) | linker(30) | BarcodeA(8) | linker(30) | UMI(12) | polyT | cDNA, while R1 carries the insert with a template-switch oligo (TSO).
Everything fits in one command:
cutseq -A DBITSEQ \
-R '{id}_BCB:{3}_BCA:{2}_UMI:{1}' \
-O mysample R1.fq.gz R2.fq.gzBuilt-in DBITSEQ scheme:
AAGCAGTGGTATCAACGCAGAGTGAATGGG...GGG : N12 AGTCGTACGCCGATGCGAAACATCGGCCAC
N8 CGAATGCTCTGGCCTCTCAAGCACGTGGAT
N8 AGATGCGAGAAGCCAACGCTTG
- Left of
:= R1's real read-5′ scaffold: the TSO (23 nt) then an auto-detected 5′ G-stretch (GAATGGG...GGG), both trimmed. - Right of
:= the barcode arm, walked on R2: UMIN12→ capture{1}, linker trimmed, BarcodeAN8→ capture{2}, linker trimmed, BarcodeBN8→ capture{3}, handle trimmed. The-Rtemplate writes@READID_BCB:..._BCA:..._UMI:.... M6AARTRis kept as a deprecated alias.--r1-primer/--r2-primerare informational only — reads start downstream of the priming site, so the sequencing primers are never trimmed.
The same library as a fully inline scheme:
cutseq -A "AAGCAGTGGTATCAACGCAGAGTGAATGGG...GGG:N12AGTCGTACGCCGATGCGAAACATCGGCCACN8CGAATGCTCTGGCCTCTCAAGCACGTGGATN8AGATGCGAGAAGCCAACGCTTG" \ -R '{id}_BCB:{3}_BCA:{2}_UMI:{1}' -O mysample R1.fq.gz R2.fq.gz
Full construct, top strand 5′ → 3′:
P5(29) | i5(8) | R1-primer(34) | TSO(23) | insert | polyA/T | UMI(12)
| rc(L1)(30) | BarcodeA(8) | rc(L2)(30) | BarcodeB(8) | rc(handle)(22)
| rc(R2-primer)(34) | i7(8) | rc(P7)(24)
If an uppercase barcode is written next to a sequencing primer, the engine
checks the scheme's two outermost adapters against a curated database of
Illumina / BGI primers (cutseq --list-primers); a fixed uppercase run
adjacent to a recognized primer is reclassified as an inline barcode (with a
warning). Custom schemes without known primers are never altered. Disable with
--no-auto-inline.
A single -d output collects every rejected read, with the reason encoded in
the name:
cutseq -A SMALLRNA -d discarded_R1.fq.gz discarded_R2.fq.gz in_R1.fq.gz in_R2.fq.gz
| Tag | Why |
|---|---|
reason=too_short |
shorter than --min-length after trimming |
reason=too_many_n |
exceeds --max-n |
reason=low_quality |
mean Phred below --min-avg-quality |
reason=no_barcode |
missing an inline barcode (with --ensure-inline-barcode) |
Without -d/-O, discard files are auto-named from the input files.
CutSeq compiles a scheme once into a lazy graph of native cutadapt modifiers (adapter cutters, renamers, quality trimmers) and runs them in a single cutadapt pass — no intermediate I/O. Each grammar token maps to a 5′/3′/ single-end emitter, and output is verified to match the legacy engine exactly across all built-in schemes, paired- and single-end.
More details: https://cutseq.yech.science
- support more library schemes