Skip to content

Navigation Menu

Sign in
Sign up

Repository files navigation

✂️ CutSeq

Pypi Releases Downloads

CutSeq is a library-aware wrapper for cutadapt. Real NGS libraries need several trimming steps performed in the correct order — encoding them all in one cutadapt command is error-prone, and chaining separate commands wastes I/O. CutSeq fixes this with a single input: what the library looks like. It compiles your library scheme into one native cutadapt pass and runs it automatically.

Take SMARTer® Stranded Total RNA-Seq Kit v3 (built-in TAKARAV3) — many operations in one pass:

Read Steps
R1 remove the 5′ p5 adapter + 3-nt linker mask · capture the 8-nt UMI & mask the 6-nt linker at the 3′ end (the 14-nt run-over when insert < read) · remove the 3′ read-through adapter · quality trim
R2 remove the 5′ read-through adapter · extract the 8-nt UMI into the read name · mask the 6-nt linker right after it · remove the 3′ read-through adapter · quality trim

Installation

pip install cutseq

Basic usage

Express the whole library as one scheme and let CutSeq do the rest:

# built-in scheme
cutseq -A TAKARAV3 test_R1.fq.gz test_R2.fq.gz
# or a custom grammar scheme
cutseq -A "ACACGACGCTCTTCCGATCTXXX-XXXXXXNNNNNNNNAGATCGGAAGAGCACACGTC"

The scheme is a top-strand molecular map: one DNA strand, 5′ → 3′, no spaces:

  • The part left of the insert marker (+ - :) is read by R1 as-is; the part right of it is the molecule's 3′ continuation and is matched on R2 as its reverse complement automatically (e.g. a right-hand AGATCGGAAGAGCACACGTC is matched on R2 as GACGTGTGCTCTTCCGATCT).
  • + = sense, - = antisense, : = unstranded.
  • Uppercase ACGT... = adapters/primers, trimmed.
  • N = random UMI, captured into the read name (NNNNNNNN / N8).
  • X = masked sequence, trimmed but not captured (XXXXXX / X6).
  • Lowercase acgt... = inline barcode, matched and captured.
  • Homopolymer tails use the dot form AAA...AAA / TTT...TTT / GGG...GGG; the 5′/3′ direction is auto-detected from the scheme layout (a run at the read start trims the 5′, elsewhere the 3′), and G<k> sets the minimum run length (e.g. G10).
  • A 3′ read-through adapter (from the other read's 5′ arm) is trimmed automatically from the opposite end of each read.
  • Numeric shorthand (N8, X6) equals the expanded run form.

Customizing read names

Captured UMIs/barcodes are appended to the read name with _ by default (@READID_CTATTAAAAA, exactly like legacy output). Use --rename for full control — cutadapt's brace variables ({id}, {header}, {cut_prefix}, {match_sequence}, {rc}, ...) plus positional captures {1}, {2}, ... in scheme order:

cutseq -A INLINE --rename '{id}_BC1:{1}_BC2:{2}_umi:rc({3})' in_R1.fq.gz in_R2.fq.gz

Transform functions wrap any capture and nest (case-insensitive):

  • rc(x) / rev(x) / comp(x) — reverse complement / reverse / complement
  • upper(x), lower(x), len(x)
  • canon(x) — canonical UMI, min(x, rc(x)), for UMI collapsing
  • left(x,k), right(x,k), slice(x,a,b) — substring helpers

In paired mode {r1.1} / {r2.1} force a specific read; an unprefixed capture resolves to its anchor read (left-side captures → R1, right-side → R2), so both mates carry the same value. Without --rename, output is byte-for-byte legacy-compatible.

Complex example: spatial barcode arm (DBiT-seq)

Spatial libraries stack several fixed-length barcodes on one arm. In DBiT-seq (deterministic barcoding in tissue, ×ばつ50 grid) R2 walks handle(22) | BarcodeB(8) | linker(30) | BarcodeA(8) | linker(30) | UMI(12) | polyT | cDNA, while R1 carries the insert with a template-switch oligo (TSO). Everything fits in one command:

cutseq -A DBITSEQ \
 -R '{id}_BCB:{3}_BCA:{2}_UMI:{1}' \
 -O mysample R1.fq.gz R2.fq.gz

Built-in DBITSEQ scheme:

AAGCAGTGGTATCAACGCAGAGTGAATGGG...GGG : N12 AGTCGTACGCCGATGCGAAACATCGGCCAC
 N8 CGAATGCTCTGGCCTCTCAAGCACGTGGAT
 N8 AGATGCGAGAAGCCAACGCTTG
  • Left of : = R1's real read-5′ scaffold: the TSO (23 nt) then an auto-detected 5′ G-stretch (GAATGGG...GGG), both trimmed.
  • Right of : = the barcode arm, walked on R2: UMI N12 → capture {1}, linker trimmed, BarcodeA N8 → capture {2}, linker trimmed, BarcodeB N8 → capture {3}, handle trimmed. The -R template writes @READID_BCB:..._BCA:..._UMI:....
  • M6AARTR is kept as a deprecated alias. --r1-primer / --r2-primer are informational only — reads start downstream of the priming site, so the sequencing primers are never trimmed.

The same library as a fully inline scheme:

cutseq -A "AAGCAGTGGTATCAACGCAGAGTGAATGGG...GGG:N12AGTCGTACGCCGATGCGAAACATCGGCCACN8CGAATGCTCTGGCCTCTCAAGCACGTGGATN8AGATGCGAGAAGCCAACGCTTG" \
 -R '{id}_BCB:{3}_BCA:{2}_UMI:{1}' -O mysample R1.fq.gz R2.fq.gz

Full construct, top strand 5′ → 3′:

P5(29) | i5(8) | R1-primer(34) | TSO(23) | insert | polyA/T | UMI(12)
| rc(L1)(30) | BarcodeA(8) | rc(L2)(30) | BarcodeB(8) | rc(handle)(22)
| rc(R2-primer)(34) | i7(8) | rc(P7)(24)

Inline-barcode auto-detection

If an uppercase barcode is written next to a sequencing primer, the engine checks the scheme's two outermost adapters against a curated database of Illumina / BGI primers (cutseq --list-primers); a fixed uppercase run adjacent to a recognized primer is reclassified as an inline barcode (with a warning). Custom schemes without known primers are never altered. Disable with --no-auto-inline.

Discarding reads with a reason

A single -d output collects every rejected read, with the reason encoded in the name:

cutseq -A SMALLRNA -d discarded_R1.fq.gz discarded_R2.fq.gz in_R1.fq.gz in_R2.fq.gz
Tag Why
reason=too_short shorter than --min-length after trimming
reason=too_many_n exceeds --max-n
reason=low_quality mean Phred below --min-avg-quality
reason=no_barcode missing an inline barcode (with --ensure-inline-barcode)

Without -d/-O, discard files are auto-named from the input files.

How it works

CutSeq compiles a scheme once into a lazy graph of native cutadapt modifiers (adapter cutters, renamers, quality trimmers) and runs them in a single cutadapt pass — no intermediate I/O. Each grammar token maps to a 5′/3′/ single-end emitter, and output is verified to match the legacy engine exactly across all built-in schemes, paired- and single-end.

More details: https://cutseq.yech.science

TODO

  • support more library schemes

About

✂️ Trim sequencing adapters from NGS data automatically

Topics

Resources

Stars

14 stars

Watchers

1 watching

Forks

Releases

Sponsor this project

Packages

Used by

Contributors

Languages

AltStyle によって変換されたページ (->オリジナル) /