Skip to content

Navigation Menu

Sign in
Sign up

Repository files navigation

Biomotif

biomotif.fly.dev

A browser workbench for sequence patterns. Describe a motif as an expression, find it in DNA, RNA or protein, and read the result — with a library of 523 documented motifs and live retrieval from the public databases.

Everything runs in the page. There is no server component: the deployment is static files, and sequences you paste or open never leave the browser.

;; a bacterial promoter: two boxes, each allowed one mismatch, 15-19 bases apart
(seq (named 'box35 (fuzzy 1 (iupac "TTGACA")))
 (named 'spacer (gap 15 19))
 (named 'box10 (fuzzy 1 (iupac "TATAAT"))))
sigma70-promoter operon 120-149 + TTGACAATAGATGCAGAAGTGCTTATAAT
 box35=TTGACA spacer=ATAGATGCAGAAGTGCT box10=TATAAT mismatches=0

A pattern is an expression rather than a string, which buys three things a regular expression cannot give you. Named parts come back as bindings, so you learn which piece matched what. A hairpin is checked for real base pairing, not just the right letters. And a pattern can be built by code, so a peptide can be turned into every DNA motif that could encode it.

Running it

No install and no dependencies — Node 20 or newer is used only to build.

npm test # 204 tests
npm run audit # provenance and evidence coverage
npm run bench # reproducible matcher benchmark
npm run test:browser # smoke-test the built page in Chrome/Chromium when installed
npm run dist # build web/dist
npm run serve # serve it with the deployed security policy

npm run build writes web/biomotif.html, the whole tool as one file.

The motif language

Form Matches
"GAATTC" that literal, on either strand, U and T alike
(iupac "TATAWAWR") a nucleotide consensus with ambiguity codes
(prosite "N-{P}-[ST]-{P}") a protein pattern in PROSITE syntax
(seq a b c) the parts one after another
(alt a b c) any one of them
(gap 15 19) 15 to 19 of anything
(run "CT" 8 20) a run of 8 to 20 pyrimidines
(repeat m 3 6) m repeated 3 to 6 times
(opt m) m or nothing
(any-of "AT") / (none-of "P") one character in or out of a set
(named 'label m) m, captured under that label
(fuzzy 2 m) a fixed-width m with up to 2 mismatches
(edit 1 "GAATTC") up to one substitution, insertion or deletion
(hairpin (stem 5 10) (loop 3 8) :wobble #t) a stem-loop whose stem really pairs
(pwm-from-sites '("TATAAA" ...) :threshold 0.8) a position weight matrix
at-start / at-end sequence boundaries

Under the editor is what the motif will do: how many characters a match can span, and which strands are searched. The canonical form appears there too, but only when it differs from what you typed — tata-box expands to (iupac "TATAWAWR"), (opt m) to (repeat m 0 1) — so an expression that is already canonical, which includes every library pattern, is not echoed back at you.

The library

523 motifs in eight files, each with a docstring, a category and, where one exists, a literature reference. The full catalogue is in docs/LIBRARY.md.

File What is in it
prokaryote.mtf sigma factor promoters, ribosome binding sites, terminators, operators, chromosome landmarks
eukaryote.mtf core promoter elements, splicing signals, poly(A) sites, transcription factor sites, telomeres, repeats, G-quadruplexes
plant.mtf PLACE and PlantCARE elements: hormone, light, stress, defence, seed and circadian
rna.mtf structure, stability, localisation, modification, microRNA targets, riboswitches, tRNA features
protein.mtf modification sites, targeting signals, structural and catalytic motifs, protease cleavage sites
tags.mtf affinity tags, linkers, phage promoters, recombinase sites, CRISPR components, cloning standards, sequencing adapters
restriction.mtf 162 restriction enzymes with cut positions and overhangs
jaspar.mtf 36 measured weight matrices from JASPAR, generated — see below

Consensus and measurement

The library describes a binding site twice over, and the difference is the point. tata-box is the consensus — TATAWAWR, one spelling with ambiguity codes, the way a textbook writes it. tbp-matrix is the same site as JASPAR measured it, a weight matrix in which every position carries its own score. Run both on a promoter and the consensus reports several candidates while the matrix picks one and says how well it scored.

There are 36 such matrices, one for each factor the library already named as a consensus, plus a few from groups it barely reached — yeast, flies, worms, plants. Each carries its JASPAR id and the paper behind it.

Their thresholds are calibrated rather than guessed. A blanket relative score is meaningless across matrices of different widths: 0.85 makes a seven-position matrix fire every few hundred bases and a thirty-three-position one almost never. tools/fetch-jaspar.mjs samples random DNA for each matrix and sets the threshold where chance would give about one match per 10,000 bases — then writes into the docstring the rate it actually achieved, because a short matrix cannot be that specific. Six positions distinguish at best one sequence in 4,096, and saying so is more useful than pretending otherwise.

Scanning skips 166 entries flagged :scan #f. Those are templates and scaffolds — pam-spcas9, umi-8 — that match almost anywhere and are meant to be searched for by name. The .mtf files are parsed in the browser as they are, so they remain the one source of truth; nothing in the build rewrites a motif.

The rail lists in name order throughout — unfiltered, by category and by search — with digits compared by value, so mirna-seed-mir21 files before mirna-seed-mir155. Motifs the loaded sequence cannot match are faded where they stand and marked needs a protein or needs DNA or RNA, rather than sorted out of the way: a name stays where you looked it up, and reading a motif is not the same as running it. Only the protein/nucleotide divide counts. An RNA motif applies to DNA, because the engine reads U and T as the same base.

Add your own with defmotif, and it joins the library:

(defmotif my-cassette
 "The barcode cassette our lab puts on every construct."
 (seq "GGTCTC" (gap 1 1) (named 'overhang (gap 4 4)) (named 'barcode (gap 8 8)))
 :category 'lab :alphabet 'dna :ref "internal, plate map 2026-03")

What this means

Above the results is a pane that says, in plain English, what you are looking at: what the sequence is, what the pattern looks for, what was found, and whether finding that much means anything.

That last part is the one people get wrong, and it is computed rather than asserted. Forty simulated background sequences preserve the observed tendency of each letter to follow another, and the pattern is run against each. The page reports their average, 90% range and an exploratory empirical probability. This is evidence of enrichment under one background model, never proof that a site is functional:

Pattern Found Expected by chance
loxp 1 0.0 only in the real sequence
t7-promoter 1 0.0 only in the real sequence
poly-a-signal 4 0.8 over-represented
e-box 17 17.9 noise

Seventeen E-box matches look like seventeen findings. They are not one. A beginner has no way to know that, so the pane says it, and the verdict carries a coloured rule so it reads at a glance. One pattern on a 2.7 kb plasmid costs about 10 ms.

The simulation draws from a seeded xorshift32 generator, so the same sequence is always explained the same way. An earlier linear congruential generator multiplied its seed past the integers a JavaScript number holds exactly, losing the low bits — 20,000 draws visited 12,889 distinct states — which quietly weakened every estimate on this page.

A scan gets separate exploratory guidance. It reports how many places the matches sit at rather than how many matches there are — several patterns routinely describe one feature, so 53 matches can be 41 places — and it warns when a pattern that acts on RNA has been found in DNA, which only means anything if that stretch is transcribed, and only from the strand that is. It is explicitly labelled exploratory: running hundreds of patterns increases the chance of an accidental hit, so each candidate must be checked separately.

Nothing in the pane comes from a model — it is all computed, so it needs no key and appears instantly. Library descriptions are quoted as their authors wrote them, for readers who know the field; everything the pane composes around them is written for readers who do not.

Fetching sequences

The page retrieves sequences directly from the public databases, with no server in between.

Files may be FASTA, bare sequence or GenBank flat files. GenBank locus names and definitions are retained; the sequence is still processed entirely in the page.

Source Reached by
NCBI Nucleotide accession (NM_000518, NC_000011) or free-text search, with NCBI field syntax
Ensembl gene symbol (HBB), stable ID (ENSG..., ENST...), or a region (11:5225464-5229395)
ENA accession
UniProt accession or search, for protein

A search reports how many the database matched, not only how many it listed. NCBI routinely matches tens of thousands, and twenty results that look like the whole answer are worse than none. Twenty come back first, forty more each time you ask, to a ceiling of two hundred — past which narrowing the search beats scrolling it.

Every fetched record carries its description, so the pane can say what a sequence is and not only what it is called. The four databases state that four ways, and one of them does not state it at all: NCBI and ENA put a title on the FASTA defline; UniProt buries one among OS=/GN=/PE= fields, which are split off to keep the organism and gene; Ensembl labels sequence with coordinates only, so the record is looked up separately for its description, and a bare region — belonging to no gene — is described by its coordinates said in words. A lookup that fails costs the description, not the sequence.

Ensembl matters most here, because it can return a gene with its upstream sequence. Fetching the canonical HBB transcript with 200 bases of upstream and searching it recovers the textbook human beta-globin promoter:

Element Motif Position
CACCC box, the KLF1 site (iupac "CCACACCC") −93
CCAAT box (iupac "CCAAT") −76
TATA box (fuzzy 1 (iupac "TATAWAWR")) −32, reading CATAAAAG

The strict Bucher consensus TATAWAWR finds nothing there: HBB's real TATA box is a natural variant with a C in the first position. It is a built-in example.

Every fetched position comes with the genome build it was read from — GRCh38, GRCm39 — in the fetch status and in the explanation of the sequence, because a position copied into another tool means nothing without it: the same HBB region sits some 40 kb away on GRCh37.

The species field is free text, since Ensembl serves tens of thousands of genomes across its divisions and no list of them belongs in a page. Focusing the field loads Ensembl's vertebrate list into the completions; typing Homo sapiens is read as homo_sapiens; and a lookup that fails is followed by one cheap question — does this species exist at all? — so homo_sapein is reported as a misspelt species, with the name meant, rather than as a gene Ensembl has never heard of.

RNAcentral is absent for a specific reason — it sends no Access-Control-Allow-Origin header, so a browser cannot call it and there is no server here to proxy through. Every other endpoint was checked before being added, and a test fails if a host is fetched that the policy does not allow.

What the page sends, and what it does not. A request goes out only when you press Fetch or Search, and carries only what is in that box: an accession, a gene symbol, a region, a search term. A sequence you paste or open from a file is never sent anywhere — matching runs in the page, and connect-src lists those four databases, openrouter.ai for the assistant, and not 'self', so the page cannot post it back to its own origin either. The assistant is the one thing that sends text you typed, and only what is in the ask box. That said, connect-src restricts where a request may go, not what it may contain; the guarantee is the short host list together with the code, not the policy by itself.

The assistant

Describe a motif in English and have the expression written for you. Two providers, tried in order:

  1. window.claude, which the Claude artifact viewer injects. Nothing to set up and no key: the request runs on the viewer's own account.
  2. OpenRouter with a key you supply, which is what the Fly deployment and any self-hosted copy use.

The key is typed into Assistant settings, held in that tab's sessionStorage, and sent only to openrouter.ai — there is no server here to send it to, and it is never written into a link. Closing the tab forgets it. The model defaults to anthropic/claude-sonnet-5 and is a free-text field, so any OpenRouter model id works; the catalogue loads into a datalist for completion. Each reply is followed by what the turn cost — model · 1,180 in · 96 out · 0ドル.0042.

Example requests sits under the ask box: 72 questions grouped by subject, with the groups that fit the loaded sequence first. Clicking one fills the box rather than sending it, so you can edit before spending a request. They are pattern-writing examples grouped by compatible alphabet, not promises that the resulting pattern occurs in the loaded sequence.

They are deliberately things the library does not already contain. A single named motif needs no assistant — you click it in the list on the left. What needs writing is the composition: two elements a set distance apart, a library motif with an extra constraint, a pattern specific to one lab's constructs. A test enforces this, because the first set of examples got it wrong: they were written out of the library's own subject matter, so the assistant's honest reply to nearly all of them was "you already have this".

The reply is constrained to a JSON schema where the model supports it, and salvaged from the surrounding text where it does not. A generated pattern is a draft, never an automatic action. Before it can replace the editor, the page compiles it locally, checks two claimed positive examples and two close negative examples, and shows every assumption the model made. Only an expression that cannot compile or execute disables Use this motif. A disagreement in the model-authored examples is shown as a warning and can regenerate its test examples, but cannot veto a valid expression. Nucleotide examples use the same contains-match, both-strands semantics as a real scan. Statistical caveats come from Biomotif's local analysis, not from the model. Revise request can explicitly refine the current draft.

Example regeneration is a separate, deliberately small request: it sends only the existing expression, alphabet and test semantics—not the language guide, library entries, earlier explanation or assumptions. It disables model reasoning, caps output at 400 tokens and stops after 20 seconds. Full motif creation is capped at 1,200 output tokens and 45 seconds.

The full-creation prompt contains the request, the loaded sequence's alphabet and a small locally selected set of relevant library definitions. Refinement includes the current motif but drops the library context because the expression already supplies it. The sequence itself is never sent to the assistant.

This is why the app still needs no server. A proxy holding one shared key would work for visitors with nothing to set up, but it would end the static deployment and put the bill behind a public URL.

Nothing else on the page depends on the assistant.

Sharing and teaching

Links. The address bar always describes what is on screen: the motif, by name when it is the library's, and where the sequence came from — which example, or which record and how it was asked for. Copy link puts the whole URL on the clipboard, so a promoter with a pattern loaded can be handed to a class. A sequence you paste or open from a file is never in a link, and neither is the assistant key. A link is typed by anyone, so what it may say is bounded: unknown keys are dropped and its numbers are clamped.

Exports. Results can be copied or downloaded as TSV, BED, GFF3 or a JSON analysis report. Each format states its coordinate convention; the JSON report also records the sequence origin, motif source, analysis mode and structured library provenance.

Walkthroughs. Two lessons at the top of the page teach the tool one step at a time. A bacterial gene, from promoter to terminator uses the built-in operon and needs no connection: it finds the promoter, the ribosome binding sites and the terminator, and on the way shows what a bad pattern looks like — start-codon matches 125 times, and chance would give 119. The human beta-globin promoter fetches HBB from Ensembl with its upstream region and finds the three textbook boxes, including the TATA box the strict consensus misses because it begins with a C. Each step says what to look for, and each step is a link (#lesson=operon/4), so a class can be sent to a given point.

The picture and the table point at each other. Clicking a row in the table scrolls the sequence to that match and flashes it — reading a position number and finding it by eye is the part beginners struggle with — and clicking a highlighted run picks out the matches it belongs to in the table. Rows are reachable with Tab and Enter.

A drawn gel. Digest shows the pieces as they would look on an agarose gel: each enzyme alone, then both, beside a 1 kb ladder, on a log scale, with a band's darkness following the fragment's mass. It is drawn with attributes and classes only, since the policy allows no inline style, and described in words for anyone who cannot see it. It is a schematic and says so under the picture: one agarose percentage, every site cut, no methylation, no partial digest, and the enzymes chosen for you. For a real simulation of a digest and its gel there is VIRGE, which models agarose percentage, pulsed fields, dam/dcm and CpG methylation, isoschizomers and partial digests.

A glossary. The words the explanation cannot avoid — strand, consensus, reading frame, weight matrix — carry a definition on hover or keyboard focus at their first appearance in each passage.

Offline. The served build keeps its own three files in a service worker, so a classroom without a connection still has the library, the examples and both offline lessons. Navigations check for a newly deployed page first and fall back to the cached copy offline, so refreshing does not silently preserve an obsolete interface. Nothing else is cached: a fetched sequence, an assistant reply and the fonts pass straight through. The worker is served under a policy of its own, because a worker's fetches answer to the policy its script came with and the page's leaves out 'self' on purpose.

Performance

The matchers are generators, so backtracking is the generator protocol. On 1 Mb of random DNA, median of five warmed runs, Node 24 on an Apple M3:

Pattern Throughput
Literal GAATTC 7.7 Mb/s
IUPAC TATAWAWR 6.4 Mb/s
Sigma-70 promoter, two fuzzy boxes and a gap 2.0 Mb/s
Hairpin, stem 5 to 10 0.1 Mb/s

Fast enough for plasmids, genes, promoter sets and bacterial genomes. Not fast enough for a vertebrate genome, and a fetch above 12 Mb is refused rather than left to crawl.

npm run bench reproduces the comparison on deterministic sequence. Library scans over records longer than 20 kb yield between batches, report progress and can be cancelled by choosing another analysis. Expensive hairpin background simulations are skipped on long records rather than freezing the page.

Deploying

The repo carries a fly.io configuration. There is no server component, so a deployment is a static build served by nginx: no secrets, no environment variables, no volumes, no database. The whole tool, including the motif library, is built into the image.

Install flyctl and sign in:

fly auth login

Claim the app name — this reserves it and starts nothing, so it costs nothing:

fly apps create biomotif

If the name is taken it fails immediately; pick another and change app in fly.toml to match. Then, from the repo root:

fly deploy

That builds the Dockerfile on Fly's remote builder — Docker does not need to be running locally. Every later deploy is the same command. The app is then at https://<app>.fly.dev.

Fly starts two machines on a first deploy, for zero-downtime deploys rather than for load. One is plenty for a static page:

fly scale count 1

The machine sleeps when idle (auto_stop_machines = 'suspend' with min_machines_running = 0), so an unvisited deployment costs nothing and the first request after an idle period pays about a second of wake-up.

To check the image locally:

docker build -t biomotif . && docker run --rm -p 8080:80 biomotif

Layout

web/src/ engine, motif builder, database clients, assistant, explanations, glossary,
 links, export formats, gel, walkthroughs, interface
web/test/ 204 tests, run with `npm test`; dom.mjs is the small DOM the interface tests run in
library/ the eight .mtf files — the motif library itself
data/ example sequences, generated by tools/make-data.mjs
tools/ build, data and index generators, and a local server
deploy/ nginx config and the content security policy
docs/ the full motif catalogue, generated

The example sequences are synthetic and reproducible: random background at a chosen GC content with real consensus elements planted at known positions, so every demo has a known right answer. CI rebuilds them and fails if they drift.

The library is also audited as a dataset. npm run audit reports evidence levels, attributable-source coverage, examples and review dates without hiding uncited entries. Each entry exposes conservative structured provenance: measured, catalogue-derived, literature-backed or uncited.

Contributing

Pull requests are welcome — see CONTRIBUTING.md, which has the recipe for adding a motif. The most valuable contribution is a motif that is wrong or a motif that is missing; only 108 of the 523 entries cite a paper, so any of them may be mistaken.

Licence

MIT — Copyright (c) 2026 Andre Paquette. See LICENSE.

The motif library is a set of published consensus sequences, each defined in a .mtf file with a docstring, and with a literature reference where one exists — 108 of the 523 carry one. Some follow catalogues with their own terms, which this licence does not override: restriction sites derive from REBASE, Copyright (c) Dr. Richard J. Roberts, free for academic use; many protein patterns are written in, and several taken from, PROSITE; plant elements draw on PLACE and PlantCARE; the weight matrices come from JASPAR under CC BY 4.0. Sequences fetched at runtime come from NCBI, Ensembl, ENA and UniProt under those services' terms. See CONTRIBUTING.md for the detail.

About

A browser workbench for DNA, RNA and protein sequence patterns: 523 documented motifs, live database retrieval, and a chance-corrected verdict on every match. Patterns are s-expressions; the page has no server and no dependencies. Also with an AI assistant generating s-expressions from natural language descriptions.

Topics

Resources

Contributing

Stars

0 stars

Watchers

0 watching

Forks

Releases

Packages

Contributors

Languages

AltStyle によって変換されたページ (->オリジナル) /