multiPrime: version 2.1.1
MultiPrime https://multiPrime.cn is a pipeline designed for broad-spectrum detection of target sequences using tNGS. It is implemented in Python and Snakemake and takes a FASTA format file as input. The pipeline has three main steps: classification by identity, primer design, and primer set combination. In the classification step, redundant sequences are removed and clusters are formed by identity. Rare sequence clusters are compared to others by average nucleotide identity, and if they are deemed similar enough, they are merged. In the primer design step, multi-alignment is performed using MUSCLE or MAFFT, and candidate primers are designed using the nearest-neighbor model. Primer pairs are selected based on PCR product length, melting temperature, dimer examination, coverage with errors, and other factors. Finally, a greedy algorithm is used to combine primer pairs into a minimal primer set according to dimer examination.
If you only require primer design without the need for primer set combination, you may use the primer design module of MultiPrime, which is accessible through scripts/multiPrime-core.py or pip install multiPrime (version >=2.4.8) and utilize the DPrime function.
multi-DegePrime: Degenerate primer design by DEGEPRIME (MC-DPD).
multiPrime-original: Degenerate primer design by multiPrime-core (MC-EDPD or MC-DPD). It allows for avoidance of mismatches at 3'end region.
multiPrime: It is an update of original. New multiPrime allows for easy avoidance of mismatches at any position, making it flexible for experienced users.
Scripts and pipelines provided in this repository aid to design multiplex PCR primer and return a minimal primerset for multi-PCR. It contains all scripts to allow a self-assembled processing and additionally provides pipeline scripts that run the entire processing automatically.
We have provided a video tutorial at here to assist you with the installation and usage of multiPrime.
- MultiPrime is a user-friendly and one-step tool for designing tNGS primer sets (cluster-specific primers or ultra multiplex PCR).
- It integrates degenerate primer design theory with mismatch handling, resulting in improved accuracy and specificity in detecting broad spectrum sequences.
- It outperformed conventional programs in terms of run time, primer number, and primer coverage.
- The versatility and potential of multiPrime is highlighted by its potential application in detecting single or multiple genes, exons, antisense strands, RNA, or other specific DNA segments.
If you find multiPrime helpful for your research or project, we kindly request that you cite the following publication:
Xia, Han et al. 2023. "MultiPrime: A Reliable and Efficient Tool for Targeted Next-Generation Sequencing." iMeta e143. https://doi.org/10.1002/imt2.143".
Citing the publication will acknowledge the contribution of multiPrime to your work and help us in further development and improvement of the tool. Thank you for your support!
To run this pipeline, your computer requires 30 GB of available memory (RAM) to process larger number of sequence (e.g. 1,000,000). Note: We don't suggest that Input sequences contains those sequences whose length is greater than 100K, if necessary, you'd better set the Maxseq in yaml file as small as possible, but do not smaller than 200. Alternatively, you may consider using conserved genes/regions instead of whole genomes. Snakemake was used to facilitate the automated execution of all analysis steps. The easiest way to make use of the pipeline is to set up a python 3.9 virtual environment and run the pipeline in this environment.
Download/Provide all necessary files (The requirements file is all set. Simply clone this repository and install via conda.):
Comparison:
DEGEPRIME-1.1.0 (multi-DegePrime): DOI: 10.1128/AEM.01403-14; Please cite: "DegePrime, a program for degenerate primer design for broad-taxonomic-range PCR in microbial ecology studies." Links: https://github.com/EnvGen/DegePrime; please move this directory into scripts.
mfeprimer-3.2.6: DOI: 10.1093/nar/gkz351; Please cite: "MFEprimer-3.0: quality control for PCR primers." please move this it into scripts. Please add "execute" to mfeprimer-3.2.6
Programs we employed:
biopython: Not required in v1.0.1 and the subsequent version.
The method for calculating Tm values in this study is a slightly modified version of primer3-py here. Reference paper: Owczarzy et al., 2004; Owczarzy et al., 2008.
The method for calculating deltaG in this study is a slightly modified version of the approach proposed by Martin et al., 2020. "Base-Pairing and Base-Stacking Contributions to Double-Stranded DNA Formation."
The method for dimer examination in this study is a slightly modified version of the approach proposed by Xie et al., 2022. "Designing highly multiplex PCR primer sets with Simulated Annealing Design using Dimer Likelihood Estimation (SADDLE)"
MUSCLE: It is already in the requirement.txt. version=v3.8.1551. http://www.drive5.com/muscle This software is donated to the public domain. Please cite: Edgar, R.C. Nucleic Acids Res 32(5), 1792-97.
MAFFT: It is already in the requirement.txt. version=v7.508 (2022/Sep/07). Please cite: "MAFFT multiple sequence alignment software version 7: improvements in performance and usability".
fastANI: It is already in the requirement.txt. version=version 1.33. Please cite: "FastANI, Mash and Dashing equally differentiate between Klebsiella species."
blast+: It is already in the requirement.txt. version=BLAST 2.13.0+. Links: https://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastNews.
bowtie2: It is already in the requirement.txt. version=version 2.2.5. DOI:10.1038/nmeth.1923; Please cite: "Fast gapped-read alignment with Bowtie 2." Links: https://www.nature.com/articles/nmeth.1923
Snakemake is a workflow management system that helps to create and execute data processing pipelines. It requires python3 and dependent environment (multi-DegePrime == multiPrime-original == multiPrime) can be most easily installed via the bioconda package of the python anaconda distribution.
conda create -n multiPrime -c bioconda -c conda-forge --file requirement.txt
if conflicts:
conda create -n multiPrime -c bioconda -c conda-forge --file requirement2.txt
or Copy multiPrime.tar.gz files from the ENV directory to your Conda environment directory and then unpack them.
cp ENV/multiPrime.tar.gz ${/path/to/your/conda/env}
tar -xzvf multiPrime.tar.gz
conda activate multiPrime
To activate the environment
source activate multiPrimeTo exit the environment (after finishing the usage of the pipeline), just execute
source deactivateThe working directory contains files named multi-DegePrime.yaml, multiPrime-original.yaml and multiPrime.yaml. These are the central file in which all user settings, paramter values and path specifications are stored. multi-DegePrime.yaml employs DEGEPRIME-1.1.0 for maximum coverage degenerate primer design (MC-DPD), multiPrime-orignal.yaml and multiPrime.yaml use multiPrime-core.py for MC-DPD or MC-DPD with error. During a run, all steps of the pipeline will retrieve their paramter values from these file. It follows the yaml syntax (find more information about yaml and it's syntax here) what makes it easy to read and edit. The main principles are:
- everything that comes after a
#symbol is considered as comment and will not be interpreted - paramters are given as key-value pair, with
keybeing the name andvaluethe value of any paramter
Before starting the pipeline, open the multiPrime.yaml configuration file and set all options according as required. This should at least include:
- name of the input directory - where are your input fasta files stored -input_dir: ["abs_path_to_input_dir"]
- name of the output directory - where should the pipeline store the output files (the direcotry is created if not existing) -results_dir: ["abs_path_to_results_dir"]
- name of the log directory - where should the pipeline store the log files -log_dir: ["abs_path_to_log_dir"]
- name of the scripts directory - where should the pipeline store the scripts files -scripts_dir: ["abs_path_to"]/multiPrime/scripts
- name(s) of your input samples - please note: If your sample is named
sample1.fathensample1will be kept as naming scheme throughout the entire run to indicate output files that belong to this input file, e.g. the pipeline will create a file calledsample1.fa. If you have multiple input files, just follow the given pattern with one sample name per line (and a dash that indicates another list item). - identity - threshold for classification. please note: If you set 1, multiPrime will design candidate primer pairs for each fasta in input files. Suggestion: 0.7-0.8.
- others - for more information on the parameters, please refer to the YAML file.
Once you set up your configuration file, running the pipeline locally on your computer is as easy as invoking:
sh run.sh
maximal coverage degenerate primer design (MC-DPD). The approach employed DegePrime to design degenerate primers for the target sequence.
snakemake --configfile multi-DegePrime.yaml -s multi-DegePrime.py --cores 10 --resources disk_mb=80000
maximal coverage degenerate primer design with errors tolerant (MC-EDPD) or MC-DPD. MultiPrime-orignal is capable of avoiding mismatches that occur at the 3'end position. The approach used in multiPrime-orignal.yaml depends on the value of the "variation" parameter.
If "variation" is set to 0, then multiPrime uses the MC-DPD approach to design degenerate primers for the target sequence. In this approach, the primer sequences are designed with prefect match (0-mismatch).
If "variation" is set to a value greater than 0, then multiPrime uses the MC-EDPD approach to design degenerate primers with errors (mismatches) tolerance (1-mismatch or 2-mismatches). In this approach, the primer sequences are allowed to contain a limited number of errors (mismatches), which increases the probability of finding suitable primer sequences for the target sequence.
snakemake --configfile multiPrime-orignal.yaml -s multiPrime-orignal.py --cores 10 --resources disk_mb=80000
multiPrime is similiar to multiPrime-orignal, but it enables easy avoidance of mismatches at any position.
snakemake --configfile multiPrime.yaml -s multiPrime.py --cores 10 --resources disk_mb=80000
Setting default parameters may not always be suitable for all conditions. If you want to design primers with more flexible parameters, you can install the multiPrime package through PyPI (Python Package Index) using pip.
pip install multiPrime (make sure the version is latest)
multiPrime --help
The multiPrime package includes various functions for designing primers, selecting primer pairs, and calculating the coverage of these primer pairs. These features have been developed to assist researchers in performing PCR experiments efficiently and accurately. The package is continuously being improved and expanded upon, with additional functions expected to be added in the future. All manual instruction for multiPrime can be found in here.
If you have already cloned this repository and do not wish to install the multiPrime package from PyPI, you can use the scripts included in this repository to perform primer design. These scripts have the same functionality as the multiPrime package and can be run locally on your computer without the need for a separate installation.
python {path to script}/{target}.py --helpor
python {path to script}/{target}.pyFor example:
Primer design with MC-DPD (--variation 0) or MC-EDPD (--variation 1 or 2. We do not recommend setting the --variation parameter greater than 2, as amplification efficiency can be severely inhibited when there are more than 2 mismatches between the primers and their targets).
python scripts/multiPrime-core.py
Usage: multiPrime-core.py -i input -o output -p 20
Options: { -l [18] -n [4] -d [10] -v [1] -e [3.6] -g [0.2,0.7] -f [0.8] -c [4] -p [10] -a [4] }
Options:
-h, --help show this help message and exit
-i INPUT, --input=INPUT
Input file: multi-alignment output (muscle or others).
-l PLEN, --plen=PLEN Length of primer. Default: 18.
-n DNUM, --dnum=DNUM Number of degenerate. Default: 4.
-d DEGENERACY, --degeneracy=DEGENERACY
degeneracy of primer. Default: 10.
-v VARIATION, --variation=VARIATION
Max mismatch number of primer. Default: 1.
-e ENTROPY, --entropy=ENTROPY
Entropy is a measurement of the degree of randomness or disorder in a system.
This parameter is utilized to determine whether a window is conserved or not.
Entropy of primer-length window. Default: 3.6.
-g GC, --gc=GC Filter primers by GC content. Default [0.2,0.7].
-s SIZE, --size=SIZE Filter primers by mini PRODUCT size. Default 100.
-f FRACTION, --fraction=FRACTION
Filter primers by match fraction. Default: 0.8.
-c COORDINATE, --coordinate=COORDINATE
Mismatch index is not allowed to locate in start or
stop region. otherwise, it won't be regard as the mis-
coverage. With this param, you can control the index
of Y-distance (number and position of mismatch) when calculate
coverage with error.Default: 4.
-p PROC, --proc=PROC Number of process to launch. Default: 20.
-a AWAY, --away=AWAY Filter hairpin structure, which means distance of the
minimal paired bases. Default: 4. Example:(number of
X) AGCT[XXXX]AGCT. Primers should not have
complementary sequences (no consecutive 4 bp
complementarities),otherwise the primers themselves
will fold into hairpin structure.
-o OUT, --out=OUT Output file: candidate primers. e.g.
[*].candidate.primers.txt.To get candidate degenerate primer pairs with high coverage.
python scripts/get_multiPrime.py
Usage: get_multiPrime.py -i input -r sequence.fa -o output
Options: {-f [0.6] -m [500] -n [200] -e [4] -p [9] -s [250,500] -g [0.2,0.7] -d [4] -a ","}.
Options:
-h, --help show this help message and exit
-i INPUT, --input=INPUT
Input file: degeprimer out.
-r REF, --ref=REF Reference sequence file: all the sequence in 1 fasta,
for example: (Cluster_96_171.fa).
-g GC, --gc=GC Filter primers by GC content. Default [0.2,0.7].
-f FRACTION, --fraction=FRACTION
Filter primers by match fraction. Default: 0.6.
Sometimes you need a small fraction to get output.
-e END, --end=END Filter primers by degenerate base position. e.g. [-t
4] means I dont want degenerate base appear at the end
four bases when primer pre-filter. Default: 4.
-p PROC, --proc=PROC Number of process to launch. default: 10.
-s SIZE, --size=SIZE Filter primers by PRODUCT size. Default [250,500].
-d DIST, --dist=DIST Filter param of hairpin, which means distance of the
minimal paired bases. Default: 4. Example:(number of
X) AGCT[XXXX]AGCT.
-a ADAPTOR, --adaptor=ADAPTOR
Adaptor sequence, which is used for NGS next. Hairpin
or dimer detection for [adaptor--primer]. For example:
TCTTTCCCTACACGACGCTCTTCCGATCT,TCTTTCCCTACACGACGCTCTTCCGATCT
(Default). If you dont want adaptor,
use [","]
-m MAXSEQ, --maxseq=MAXSEQ
The default value for the limit of sequence number is set at 500.
However, if the value is set to 0, then all sequences will be taken into consideration.
It is important that this parameter remains consistent with the [max_seq]
parameter used in multi-alignment [muscle].
-o OUT, --out=OUT Output file: candidate primers. e.g.
[*].candidate.primers.txt.To extract primers of your amplicons from Oxford Nanopore Technology (ONT) reads. FindONTprimerV2.py = FindONTprimerV3.py. If your primers are degenerate, you can use the "FindONTexpandprimer.py" script included in the multiPrime package. This script is designed specifically to identify degenerate primer sequences from ONT reads and expand them into their full, non-degenerate forms.:
python scripts/FindONTprimerV3.py
Usage: FindONTprimerV3.py -i [input] -s [primer set] -p [20] -l [primer length] -m [0.6] -f [fq] -o [output]. Options: -h, --help show this help message and exit -i INPUT, --input=INPUT Input file: fastq or fasta or fq.gz or fa.gz. -s SET, --set=SET primer set file. -p NPROC, --nproc=NPROC Primer set file. option. Default: 10 -l LEN, --len=LEN Primer length. Default: 18 -m MIN_IDENT, --min_ident=MIN_IDENT min identity. Default: 0.6 -f FORMAT, --format=FORMAT Input format can be fasta, fastq, fa.gz and fq.gz. Default: fastq -o OUT, --out=OUT Output file: candidate primers. e.g. [*].candidate.primers.txt.
To extract PCR products with perfect matches from your input FASTA file:
python scripts/extract_PCR_product.py
Usage: extract_PCR_product.py -i [input] -r [reference] -p [10] -f [format] -o [output]
Options:
--version show program's version number and exit
-h, --help show this help message and exit
-r REF, --ref=REF reference file: template fasta or reference fasta.
-i INPUT, --input=INPUT
Primer file. One of the followed three types:
final_maxprimers_set.xls primer.fa
primer_F,primer_R.
-f FORMAT, --format=FORMAT
Format of primer file: xls or fa or seq; default: xls.
xls: final_primer_set.xls, output of multiPrime. fa:
fasta format. seq: sequence format, comma seperate.
e.g. primer_F,Primer_R.
-o OUT, --out=OUT Output_dir. default: PCR_product.
-p PROCESS, --process=PROCESS
Number of process to launch. default: 10.
-s STAST, --stast=STAST
Stast information: number of coverage and total.
default: Coverage.xls
To extract PCR products with mismatches from your input FASTA file
python scripts/primer_coverage_validation_by_BWT.py
Usage: primer_coverage_validation_by_BWT.py -i [input] -r [bowtie index] -l [150,2000] -p [10]-o [output]
Options:
-h, --help show this help message and exit
-i INPUT_FILE, --input=INPUT_FILE
input file: primer.fa.
-r REF, --ref=REF reference file: template fasta or reference fasta.
-l LEN, --len=LEN Length of primer, which is used for mapping. If the length of the primer used for
mapping is set to 0,the entire length of the primer will be utilized. Default: 0
-t TERM, --term=TERM Position of mismatch is not allowed in the 3 term of
primer. Default: 4
-s SIZE, --s=SIZE Length of PCR product, default: 150,2000.
-p PROC, --proc=PROC Number of process. Default: 20
-b BOWTIE, --bowtie=BOWTIE
bowtie/ABS_path(bowtie) or bowtie2/ABS_path(bowtie2) was employed for mapping.
Default: bowtie2
-m SEEDMMS, --seedmms=SEEDMMS
Bowtie: Mismatches in seed (can be 0 - 3, default: -n
1).Bowtie2: Gap or mismatches in seed (can be 0 - 1,
default: -n 1).
-d DICT, --dict=DICT
Dictionary of targets sequences, binary format. Default: None.
It can be obtained from prepare_fa_pickle.py (https://github.com/joybio/multiPrime).
-o OUT, --out=OUT Prodcut of PCR product with primers.
Others ...
logs: log file of the multiPrime.py
results: results directory
-cluster.identities: identity of each sequence.
-cluster.txt: cluster information. for example: Cluster_0_222.fa, 0 ==> cluster rank; 222 ==> sequence number.
-history.txt: history of clusters with rare sequence numbers are compared with others by average nucleotide identity.
-Total_fa: genome file and cluster of genome file.
--Bowtie_DB: the Bowtie_DB is a pre-built index of a reference genome that is created from an input FASTA file.
--*.format.fa: reformat input fasta file. This process involves modifying the structure of the file to ensure compatibility with downstream analysis tools.
--*.dict: binary dict of input fasta file.
--*.filtered.fa: filtered fasta. These fasta will not used in the downstream steps.
--*.clstr: cluster information
-Clusters_fa: genome file split by each cluster.
--*.fa: fasta of each cluster, only acc_ID. For complete names, please refer to the files located in the "Clusters_target" directory.
--*.tfa: top N {default: 500 randomly selected. Always contain the representative seq} fasta of each cluster
--*.txt: accession id of each cluster
-Clusters_msa: alginment by muscle
--*.tmsa: muscle output of the top N {default: 500 randomly selected. Always contain the representative seq}
-Clusters_trim_msa: trimmed alignment by degePrimer
--*.trim.tmsa: trimmed muscle by degePrimer
-Clusters_primer: get_degePrimer from degePrimer out
--*.out: paired primers designed by the top N {default: 500} fasta
--*.gap_seq_id_json: Positions and non-contained sequences caused by gap.
--*.non_coverage_seq_id_json: Positions and non-contained sequences caused by others.
-Clusters_cprimer: candidate primers for each cluster.
--*.fa: candidate primers in fa format
--*.txt: candidate primers in txt format (1 line)
--*.xls: candidate primers in xls format
-Clusters_target: information of each cluster.
--*.txt: full name of each sequences in each cluster. You can get the full information of sequences from these files.
-Primers_set:
--candidate_primers_sets.txt: all candidate primers in each cluster
--candidate_primers_sets: directory contain all candidate primers in fasta
--sort.candidate_primers_sets.txt: sorted by the number of candidate primers in each line (cluster)
--final_maxprimers_set.fa: fasta format of primers set for multiPCR
--final_maxprimers_set.xls: primers information of primers set
--final_maxprimers_set.next.xls: primer set 2
--Coverage_stast.xls: coverage of all primers in primer set (perfect match)
--final_maxprimers_set.fa.dimer: dimer check by mfePrimer
--final_maxprimers_set.fa.hairpin: hairpin check by mfePrimer
--PCR_product: perfect PCR product of each primer
-Core_primers_set:
--BWT_coverage: coverage of all primers in core primer set (up to 2-mismatch)
--*.out: the start and stop positions of each accession and its corresponding primer pair.
--*.pair.num: the target number of each primer.
--*.total.acc.num: the total target number of final primer sets.
--*.unmatched.fa: the sequences that were not captured by the core primer set with setting mismatches.
--core_candidate_primers_sets.txt: core candidate primers in each cluster
--core_candidate_primers_sets: directory contain all core candidate primers in fasta
--sort.core_candidate_primers_sets.txt: sorted by the number of core candidate primers in each line (cluster)
--core_final_maxprimers_set.fa: fasta format of core primers set for multiPCR
--core_final_maxprimers_set.xls: primers information of core primers set
--core_final_maxprimers_set.next.xls: primer set 2
--core_Coverage_stast.xls: coverage of all primers in core primer set (perfect match)
--core_candidate_primers_sets.fa: core primer set fasta
--core_candidate_primers_sets.number: candidate primer number of each core cluster
--core_final_maxprimers_set.fa.dimer: dimer check by mfePrimer
--core_final_maxprimers_set.fa.hairpin: hairpin check by mfePrimer
--core_PCR_product: core PCR product of each primer
--Column 1: Primer Information
Format: Cluster_X_Y
X: Index number of the cluster (e.g., Cluster_1, Cluster_2).
Y: Total number of sequences within the cluster.
--Column 2: Primer-F Sequence
Nucleotide sequence of the forward primer.
--Column 3: Primer-R Sequence
Nucleotide sequence of the reverse primer.
--Column 4: PCR Parameters
Format: Length:Annealing_Temperature:Primer_Coverage
Length: Amplicon size (base pairs).
Annealing Temperature: Optimal temperature (°C) for primer binding.
Primer Coverage: Percentage of target sequences covered by the primer pair.
--Column 5: Capture Efficiency
Number of sequences captured or amplified by the primer pair.
--Column 6: Binding Coordinates
Start and end positions of the primer pair relative to the reference sequence (e.g., 120:250).
The project was conceptualized and scripted by Junbo Yang.Please send comments, suggestions, bug reports and bug fixes to 1806389316@pku.edu.cn / yang_junbo_hi@126.com.
This repository is updated frequently. Expect breaking changes. More functions will be improved in the future and a new version is comming.