Skip to content

Navigation Menu

Sign in
Sign up
This repository was archived by the owner on Sep 18, 2025. It is now read-only.

Repository files navigation

Important

This repository is deprecated and no longer maintained. Development continues at RNABioInfo/RNAnue. Checkout the develop branch for the latest updates.

docker-release

RNAnue - 0.2.5

About

RNAnue is a comprehensive analysis to detect RNA-RNA interactions from Direct-Duplex-Detection (DDD) data.

Install

Dependencies

RNAnue has the following dependencies, whereas the brackets indicate the version RNAnue has been build and tested on. Make sure the requirements are satified by your system. cmake is able to detect the Boost libraries system-wide. However, Seqan3 is expected to be located in the current folder of RNAnue as specified in the CMakeLists.txt. Segemehl and the Vienna binaries need to be located in $PATH.

CMake

RNAnue is build using CMake. At first, clone the repository and change into the source directory.

git clone https://github.com/Ibvt/RNAnue.git
cd RNAnue 

In the next step, retrieve the SeqAn library and place it in the root folder of RNAnue. CMake is a cross-platform Makefile generator. For that, we provide the CMakeLists to simplify the build process. In particular, it utilizes the instructions given in the CMakeLists. It is recommended to create a "out-of-source build". For that, create a build folder (e.g., ./bin) and cmake into the root directory.

cmake ../source/

This is be sufficient if the dependencies are located in $PATH. Calling make builds RNAnue.

Overview

Principle

Usage

Positional Arguments

RNAnue provides different functional arguments (subcalls) for individual procedures. These include RNAnue preproc, RNAnue align, RNAnue clustering, RNAnue analysis. In additon, RNAnue complete applies the whole workflow.

Input

RNAnue requires the sequencing files to be in a specific folder structure. The root folders of the treatments (--trtms) and controls (--ctrls) are specified accordingly. These folders contain subfolders with arbitrary conditions (e.g., treatment, cell lines,...) that in turn contain the read files, e.g.,

./trtms/
 condition1 
 condition2
./ctrls
 condition1
 condition2

It is to be noted that the --trtms needs to be specified. However, --ctrls may be not set (optional).

Parameters

RNAnue accepts parameter settings both from the commandline and through a configuration file. For the latter, we provide a template configuration file (params.cfg) that allows to set the parameters in a more convenient fashion. This means that the call of RNAnue is reduced to the following call.

RNAnue <subcall> --config /path/to/params.cfg

Here, subcall corresponds to positional arguments.In any case, the specifying parameters over the command lines has precedence over the config file.

Results

In principle, the results of the analysis are stored in the specified output folder and its subfolders (e.g., ./preproc, ./align, ./clustering, ./analysis). RNAnue reports the split reads in SAM format, the clusters and the RNA-RNA interactions. RNAnue reports the split reads in SAM format. Additionally, the complementarity scores and hybridization energies are stored in the tags FC and FE, respectively. We report the clusters in a custom format that includes the IDs of the clusters, its length, size and genomic coordinates.

Split Reads (.BAM)

RNAnue reports the detected splits in .SAM format (RNAnue detect). In this file, pairs of rows represent the split reads, consisting of the individual segments, e.g

A00551:29:H73LYDSXX:1:1101:7274:10645	16	gi|170079663|ref|NC_010473.1|	3520484	22	1X51=	*	0	0	AGGGGTCTTTCCGTCTTGCCGCGGGTACACTGCATCTTCACAGCGAGTTCAA	*	XA:Z:TTTCTGG	XC:f:0.714286	XE:f:-15.6	XL:i:7	XM:i:5	XN:i:0	XR:f:0.0735294	XS:i:5	XX:i:1	XY:i:52
A00551:29:H73LYDSXX:1:1101:7274:10645	16	gi|170079663|ref|NC_010473.1|	3520662	22	11=5S	*	0	0	TTCGATCAAGAAGAAC	*	XA:Z:GAAGAAC	XC:f:0.714286	XE:f:-15.6	XL:i:7	XM:i:5	XN:i:0	XR:f:0.0735294	XS:i:5	XX:i:53	XY:i:68

In the following the tags are listed that are reported in the detected split reads. Please note that in the upper segment the alignment is in reverse as done in the calculation of the complemtarity to represent the 3-5 and 5-3 duplex.

tag description
XC:f complementarity
XL:f length of alignment
XS:i alignment score
XM:i matches in alignment
XR:f site length ratio
XA:Z alignment of sequence
XE:f hybridization energy
XD:f MFE structure in dot-bracket notation

Clustering results

The clustering procedure reports a single clusters.tab file which is a tab-delimited file of the clustering results. Here, each line represents a cluster that corresponds to overlapping split reads, defined by the two segments. The columns are defined in the following:

Field Description
clustID Unique identifier of the cluster
fst_seg_chr Chromosome (accession) of the first segment
fst_seg_strd Strand where the first segment is located
fst_seg_strt Start position of the first segment in the cluster
fst_seg_end End position of the first segment in the cluster
sec_seg_chr Chromosome (accession) of the second segment
sec_seg_strd Strand where the second segment is located
sec_seg_strt Start position of the second segment in the cluster
sec_seg_end End position of the second segment in the cluster
no_splits Number of split reads in the cluster
fst_seg_len Length of the first segment
sec_seg_len Length of the second segment

Interaction table

The analysis procedure generates _interactions files for each library in which each line represents an annotated split read that is mapped to a transcript interaction. The fields are defined as follows:

Field Description
qname read/template identifier
fst_seg_strd Strand where the first segment is located
fst_seg_strt Start position of the first segment
fst_seg_end End position of the first segment
fst_seg_ref Reference name of the first segment corresponding to the seqid in GFF and/or clusterID
fst_seg_name Name of the first segment that corresponds to gene name/symbol and/or clusterID
first_seg_bt Biotype of the annotation transcript (if available)
fst_seg_anno_strd Strand information of the transcript in the overlapping annotation
fst_seg_prod Description of the transcript (if available in annotation)
fst_seg_ori Orientation of the segment with respect to annotation (sense/antisense)
sec_seg_strd Strand where the second segment is located
sec_seg_strt Start position of the second segment
sec_seg_end End position of the second segment
sec_seg_ref Reference name of the second segment corresponding to the seqid in GFF and/or clusterID
sec_seg_name Name of the second segment that corresponds to gene name/symbol and/or clusterID
sec_seg_bt Biotype of the annotation transcript (if available)
sec_seg_anno_strd Strand information of the transcript in the overlapping annotation
sec_seg_prod Description of the transcript (if available in annotation)
sec_seg_ori Orientation of the segment with respect to annotation (sense/antisense)
cmpl Complementarity score of the interaction
fst_seg_compl_aln Alignment results in the complementarity calculation of the first segment
sec_seg_cmpl_aln Alignment results in the complementarity calculation of the second segment
mfe Hybridisation energy of the interaction
mfe_struc Minimum free energy (MFE) structure of interaction in dot-bracket notation

The main result of an RNAnue analysis are transcript interactions. They are stored in the file allints.txt in the same directory. Its entries are structured as described in the following where columns with prefix are given for each sample specified in the analysis (within the same file).

Field Description
fst_rna Gene/Transcript name of the first interaction partner
sec_rna Gene/Transcript name of the second interaction partner
fst_rna_ori Orientation of the first interaction partner with respect to annotation (sense/antisense)
sec_rna_ori Orientation of the second interaction partner with respect to annotation (sense/antisense)
<sample>_supp_reads Number of (split)reads that support the interaction
<sample>_ges Global energy score (gcs) of the interaction
<sample>_ghs Global hybridisation score (ghs) of the interaction
<sample>_pval Statistical significance (p-value) of the interaction
<library>_padj Benjamini-Hochberg adjusted p-value among the samples

If the option –outcnt is set to 1 RNAnue generates the count table counts.txt in the output directory. It contains the counts of each interaction for each sample and can be used for differential expression analysis. Similarly, –outjgf set to 1 generates a graph.json file that contains the detected interactions in JSON graph format. Finally, –stats set to 1 creates a stats.txt file that contains basic statistics for each step of the analysis.

Docker

In additon, we provide a ready-to-use Docker container that has RNAnue preconfigured.

Singularity

The provided Docker container can also be used with Singularity.

singularity pull docker://cobirna/rnanue:latest
singularity exec --bind /path/to/data:/data rnanue_latest.sif RNAnue <subcall> --config /data/params.cfg

Testing

We provide a test dataset in the test folder that can be used to test the installation. For that, test/humanSE.cfg can be used by specifying it in the --config parameter (needs to be absolute path).

RNAnue <subcall> --config /path/to/RNAnue/test/humanSE.cfg

Troubleshooting

contact cobi@ibvt.uni-stuttgart.de or create an issue

Releases

Packages

Used by

Contributors

Languages

AltStyle によって変換されたページ (->オリジナル) /