Skip to main content
NCBI home page
As a library, NLM provides access to scientific literature. Inclusion in an NLM database does not imply endorsement of, or agreement with, the contents by NLM or the National Institutes of Health.
Learn more: PMC Disclaimer | PMC Copyright Notice
[画像:NIHPA Author Manuscripts logo]
. Author manuscript; available in PMC: 2019 Feb 12.
Published in final edited form as: Cancer Cell. 2018 Feb 2;33(2):259–273.e7. doi: 10.1016/j.ccell.201801001

RHOA G17V induces T follicular helper cell specification and promotes lymphomagenesis

Jose R Cortes 1, Alberto Ambesi-Impiombato 1, Lucile Couronné 2,3,4, S Aidan Quinn 1, Christine S Kim 1, Ana Carolina da Silva Almeida 1, Zachary West 1, Laura Belver 1, Marta Sanchez Martin 1, Laurianne Scourzic 5,6,7, Govind Bhagat 8, Olivier A Bernard 5,6,7, Adolfo Ferrando 1,8,9, Teresa Palomero 1,8,*
1Institute for Cancer Genetics, Columbia University, New York, NY 10032, USA
2Department of Adult Hematology, Necker Hospital, Paris 75993, France
3INSERM U 1163, CNRS ERL 8254, Institut Imagine, Paris 75015, France
4Paris Descartes University, Paris 75006, France
5Gustave Roussy, Villejuif 94805, France
6INSERM U1170, Villejuif 94805, France
7Université Paris-Sud, Orsay 91400, France
8Department of Pathology and Cell Biology, Columbia University Medical Center, New York, NY 10032, USA
9Department of Pediatrics, Columbia University Medical Center, New York, NY 10032, USA
*

corresponding author and Lead Contact: Teresa Palomero, Associate Professor of Pathology and Cell Biology at Columbia University Medical Center, Institute for Cancer Genetics, Columbia University Medical Center, 1130 St Nicholas Ave; ICRC-401B, New York, NY, 10032, Phone: 212-851-4778, FAX: 212-851-5256, tp2151@columbia.edu

Issue date 2018 Feb 12.

PMCID: PMC5811310 NIHMSID: NIHMS938147 PMID: 29398449
The publisher's version of this article is available at Cancer Cell

SUMMARY

Angioimmunoblastic T cell lymphoma (AITL) is an aggressive tumor derived from malignant transformation of T follicular helper (Tfh) cells. AITL is characterized by loss-of-function mutations in Ten-Eleven Translocation 2 (TET2) epigenetic tumor suppressor and a highly recurrent mutation (p.Gly17Val) in the RHOA small GTPase. Yet, the specific role of RHOA G17V in AITL remains unknown. Expression of Rhoa G17V in CD4+ T cells induces Tfh cell specification; increased proliferation associated with ICOS upregulation and increased PI3K and MAPK signaling. Moreover, RHOA G17V expression together with Tet2 loss resulted in development of AITL in mice. Importantly, Tet2−/− RHOA G17V tumor proliferation in vivo can be inhibited by ICOS/PI3K-specific blockade, supporting a driving role for ICOS signaling in Tfh cell transformation.

Keywords: Angioimmunoblastic T cell lymphoma, T follicular helper cells, RHOA G17V, TET2, ICOS

eTOC

Cortes et al. show that expression of Rhoa G17V in CD4+ T cells drives proliferation and Tfh polarization, and they develop an angioimmunoblastic T cell lymphoma model by combining Rhoa G17V expression and Tet2 loss. These tumors show increased ICOS and PI3K/MAPK signaling and are sensitive to pathway inhibition.

[画像:graphic file with name nihms938147u1.jpg]

INTRODUCTION

Peripheral T cell lymphomas (PTCL) are a heterogeneous group of lymphoid tumors originating from mature T cells. Among these, angioimmunoblastic T cellT cell lymphoma (AITL) accounts for almost 20% of PTCL cases and is associated with immune deregulation, high resistance to conventional chemotherapy and a dismal survival rate of 30% at 5 years (Federico et al., 2013; Mourad et al., 2008). Histologically, AITL tumors show diffuse lymphoid infiltration with effacement of the lymph node architecture and prominent arborization of endothelial venules (Mourad et al., 2008). Immunohistochemical analyses (Dupuis et al., 2006; Grogg et al., 2006) and gene expression profiling studies (de Leval et al., 2007; Piccaluga et al., 2007) have established Tfh cells as the normal counterpart and predicted cell-of-origin of AITL. Yet, clonal neoplastic Tfh cells account for only a small fraction of the lymphocytic infiltrate, which is primarily composed of reactive T and B lymphocytes, and a variety of other cell types, including dendritic cells, eosinophils, histiocytes, and plasma cells (Mourad et al., 2008). Despite these findings, the mechanisms that drive Tfh cell transformation in AITL remain largely unclear.

Tfh cells are a subtype of effector CD4+ T helper cells that are characterized by expression of CXCR5, BCL6 and PD1 (Crotty, 2014). These cells are generated in the germinal centers where they play a key role in promoting the differentiation and survival of B cells (Crotty, 2014). Tfh cell differentiation is initiated by the interaction of a naive CD4+ T lymphocyte with dendritic cells in a developing germinal center (Goenka et al., 2011). This interaction involves the activation of the inducible co-stimulator (ICOS) in the T cell (Stone et al., 2015; Weber et al., 2015) and the consequent activation of the phosphoinositide 3-kinase (PI3K) pathway, which leads to expression of the BCL6 transcription factor, a critical regulator of Tfh development (Hatzi et al., 2015).

Genetically, AITL is characterized by a recurrent RHOA G17V mutation present in 70% of cases, frequently in association with loss of function mutations in the TET2 tumor suppressor gene (Palomero et al., 2014; Sakata-Yanagimoto et al., 2014; Yoo et al., 2014). RHOA belongs to the RHO family of small GTPases, a group of Ras-like proteins responsible for linking a variety of cell-surface receptors to intracellular effector proteins involved in the control of cell morphology, migration, signaling, proliferation and survival (Boulter et al., 2012; Jaffe and Hall, 2005). Similar to other small GTPases, RHOA cycles between active GTP-bound and inactive GDP-bound states. RHOA activation is mediated by RHO guanine nucleotide exchange factors (GEFs), which facilitate the exchange of GDP for GTP. In biochemical and cellular assays RHOA G17V shows impaired GTP loading, fails to activate RHOA effector proteins and ultimately interferes with the activity of wild-type (WT) RHOA, potentially by sequestering or altering the activity of the RHO GEFs (Palomero et al., 2014).

In vitro analyses of RHOA signaling using constitutively active (G14V) and dominant negative (T19N) mutants, have implicated RHOA in different aspects of T cell biology including the modulation of T cell polarization and migration (del Pozo et al., 1999), T cell spreading after T cell receptor (TCR) engagement (Borroto et al., 2000) and potentiation of AP-1 transcriptional activity during T cell activation (Chang et al., 1998). In vivo analyses of T cell-specific Rhoa conditional knockout mice revealed broad defects in thymocyte development across all thymic subpopulations (Zhang et al., 2014) and reduced numbers of mature CD4+ and CD8+ single positive populations (Zhang et al., 2014) supporting an essential role for RHOA during T cell development. However, the functional role of the RHOA G17V mutant during T cell development and in AITL transformation remains to be characterized.

RESULTS

Expression of Rhoa G17V induces Tfh cell polarization

To investigate the role of the RHOA G17V mutation in T cell development and the pathogenesis of AITL, we engineered a knock-in mouse line with conditional expression of this mutation in the endogenous Rhoa locus (Rhoaco-G17V) (Figure S1A–B). To induce the expression of the Rhoa G17V allele in CD4+ T cells, we crossed Rhoaco-G17V/+ knockin mice with the CD4CreERT2 transgenic line, which expresses a tamoxifen-inducible form of Cre specifically in CD4+ T cells (Aghajani et al., 2012). In this model, tamoxifen-induced activation of Cre recombinase induces expression of Rhoa G17V mutant transcripts in CD4+ T cells (Figure S1C and D).

Given the close association of the RHOA G17V mutation with AITL, we hypothesized that activation of the Rhoa G17V allele could promote Tfh cell polarization in CD4+ T cells. To evaluate this possibility we crossed Rhoaco-G17V/+;CD4CreERT2 mice with OT-II transgenic mice, which express the T cell receptor alpha- and beta- chain specific for chicken ovalbumin (OVA), and generated OT-II;Rhoaco-G17V/+;CD4CreERT2 mice. We then transferred either vehicle- or 4-hydroxytamoxifen-treated naive CD4+ T cells from this line or from an OT-II;CD4CreERT2 control line into Ly5.1+ C57BL/6 recipient mice that were subsequently immunized with OVA conjugated to 4-hydroxy-3-nitrophenylacetyl (NP-OVA) and monitored Tfh polarization by analysis of the expression of Tfh surface markers (Lu et al., 2011). We found that the OT-II;RhoaG17V/+ T cell population contained a significantly higher frequency and number of CXCR5+ PD1+ Tfh cells compared to the corresponding isogenic wild-type Rhoa expressing control (Figure 1A). In parallel, in vivo tamoxifen-induced expression of Rhoa G17V in non-immunized RhoaG17V/+;CD4CreERT2 knock-in mice also led to increased numbers of CXCR5+ PD1+ Tfh cells (Figure 1B) and BCL6+ CXCR5+ Tfh cells (Figure 1C). Similarly, in vitro culture of and 4-hydroxytamoxifen-treated naive CD4+ T cells from CD4CreERT2 control and Rhoaco-G17V/+;CD4CreERT2 mice under Tfh differentiation conditions resulted in increased numbers of Tfh cells expressing CXCR5 and PD1 when compared to vehicle treated cell cultures (Figure 1D). In accordance with the immunophenotypic analysis, gene expression profiling of CD4+ T cells from RhoaG17V/+;CD4CreERT2 knock-in mice identified increased expression of multiple markers associated with Tfh cell identity upon tamoxifen induction of Rhoa G17V,, including Pdcd1 (PD1), BCL6 and Icos (Figures 1E). Consistently, gene set enrichment analysis performed on RNAseq data from CD4+ T cells from CD4CreERT2 control and RhoaG17V/+;CD4CreERT2 knock-in mice treated with vehicle only or tamoxifen demonstrated enrichment of a Tfh cell signature (Chtanova et al., 2004) specifically in CD4+ T cells expressing the Rhoa G17V mutant allele (Figure 1F and G).

Figure 1. Rhoa G17V expression induces Tfh differentiation and is associated with upregulation of Tfh associated markers.

Figure 1

(A) Representative FACS plot and associated quantification of PD1 and CXCR5 expression in wild-type (WT) or Rhoa G17V-expressing CD4+ T cells from OT-II;Rhoaco-G17V/+;CD4CreERT2 donors treated with vehicle only or 4-hydroxytamoxifen (TMX), transferred into Ly5.1+ C57BL/6 mice and assessed 3 days after immunization of recipients with NP-OVA in alum. (B) Representative FACS plot and associated quantification of PD1 and CXCR5 Tfh cell markers in splenic CD4+ T cells isolated from Rhoaco-G17V/+;CD4CreERT2 (Rhoa G17V) and CD4CreERT2 (WT) mouse lines treated with vehicle alone (control) or tamoxifen in vivo. (C) Representative FACS plot and associated quantification of PD1 and BCL6 Tfh cell markers in splenic CD4+ T cells obtained as described in (B). (D) Representative FACS plot and associated quantification showing expression of Tfh markers PD1 and CXCR5 in CD4+ T cells isolated from Rhoaco-G17V/+; CD4CreERT2 (Rhoa G17V) and CD4CreERT2 control (WT) treated with vehicle only or 4-hydroxytamoxifen (TMX) and cultured under Tfh differentiation conditions. (E) Heat map representation of Tfh-associated marker expression in CD4+ T cells from CD4CreERT2 control and Rhoa co-G17V/+;CD4CreERT2 knockin mice treated with vehicle only or tamoxifen (TMX). (F) Gene Set Enrichment Analysis revealed enrichment in a Tfh signature (Chtanova, 2004) associated with the presence of the Rhoa G17V mutant allele. (G) Heat map representation of the top ranking genes in the leading edge. For gene expression analysis, two independent replicas were analyzed per genotype. Black lines above the heat maps in (E) and (G) indicate the different genotypes. Genes in heat maps are shown in rows, and each individual sample is shown in one column. The scale bar shows color-coded differential expression from the mean in s.d. units, with red indicating higher expression and blue indicating lower expression. For in vivo experiments (panels A–D), the data correspond to two independent experiments (n=3 animals/group). p values were calculated using a two-tailed Student’s t-test. Error bars, mean ± s.d. *p ≤ 0.05, **p ≤ 0.01, *** p ≤ 0.001. See also Figure S1.

Next, we asked if, in addition to its role in Tfh polarization, Rhoa G17V expression could drive differentiation towards other T cell lineages. Indeed, we detected increased numbers of FOXP3+ CD25+ T regulatory (Treg) cells and FOXP3+ CXCR5+ T follicular helper regulatory cells (Tfr) upon Rhoa G17V induction (Figures S1E and F), while differentiation of IFNG+ T helper 1 cells (TH1) was not affected (Figure S1G). Of note, tamoxifen-induced expression of Rhoa G17V in Rhoaco-G17V/+;CD4CreERT2 mice did not affect the generation of CD4+ and CD8+ cells in the thymus (Figure S1H).

Rhoa G17V-mediated induction of Tfh cell fate is associated with increased ICOS signaling

Tfh development is a multistep process that involves the dynamic interplay of naive CD4+ T cells with antigen-presenting cells (APCs) and B cells at the interface between the lymphoid follicle and the T cell zone, where they are exposed to the ICOS ligand (Crotty, 2014). Notably, analysis of ICOS expression revealed markedly increased ICOS levels in naive CD4+ CD69− T cells isolated from tamoxifen-treated RhoaG17V/+;CD4CreERT2 mice compared with Rhoaco-G17V/+;CD4CreERT2 vehicle treated controls (Figure 2A). In addition, in vitro analysis of CD4+ T cells activated with anti-CD3 (a-CD3) antibodies plus irradiated APCs (iAPCs) revealed an increased in ICOS expression at low and moderate levels of TCR engagement in Rhoa G17V-expressing cells compared with controls (Figure 2B). Next, and to test the role of Rhoa G17V in promoting increased TCR ICOS co-stimulation signaling, we first induced strong anti-CD3 plus anti-CD28 antibody-mediated T cell activation in control and Rhoa G17V-expressing CD4+ T cells to achieve increased equivalent levels of ICOS expression in the two groups (Figure 2C). We then tested the effects of treatment with anti-CD3 plus anti-ICOS antibodies under these conditions and found that, in response to TCR-ICOS co-stimulation, Rhoa G17V-expressing CD4+ T cells exhibited increased PI3K-mTOR and MAPK signaling, as measured by enhanced and longer sustained AKT and ERK1/2 activation (Figure 2D) and increased S6 phosphorylation (Figure 2E). The activation of the PI3K and MAPK pathways was associated with increased proliferation (Figure 2F) and higher levels of secreted inflammatory cytokines (Figure 2G). These results support a role for the Rhoa G17V mutation in the induction of increased ICOS expression and signaling in CD4+ T cells.

Figure 2. Rhoa G17V expression induces ICOS expression and signaling in CD4+ T cells.

Figure 2

(A) Representative FACS plot and associated quantification of the expression of ICOS in resting (CD69low) and activated (CD69high) CD4+ T cells from Rhoaco-G17V/+;CD4CreERT2 mice treated with vehicle alone (WT) or tamoxifen (Rhoa G17V) in vivo. (B) Analysis of surface ICOS expression by flow cytometry in Rhoaco-G17V/+;CD4CreERT2 CD4+ T cells treated with vehicle alone (WT) or tamoxifen (Rhoa G17V) after stimulation with increasing doses of anti-CD3 (a-CD3) antibody in the presence of iAPCs. (C) Analysis of ICOS expression in WT and Rhoa G17V-expressing CD4+ T cells following full stimulation with anti-CD3 and anti-CD28 antibodies. (D–G) WT and Rhoa G17V-expressing CD4+ T cells were pretreated with anti-CD3 plus anti-CD28 antibodies and the following analyses were performed after in vitro re-stimulation with anti-CD3 and anti-ICOS (a-ICOS) antibodies: ERK1/2 and AKT phosphorylation [Mean Fluorescence Intensity (MFI) values for WT (in black) and RhoaG17V-expressing cells (red) are indicated] (D); S6 ribosomal protein phosphorylation (E); Cell Trace Violet (CTV) cell proliferation analysis (F), and quantification of pro-inflammatory cytokines from conditioned media (G). p value in (A) was calculated with two-tailed Student’s t-test from using n=3 animals/group from two independent experiments. p values in (B) and (G) were calculated with two-tailed Student’s t-test from triplicates samples from three independent experiments. Error bars, mean ± s.d. *p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001.

Rhoa G17V expression in CD4+ T cells increases cell proliferation

The observation that Rhoa G17V expression promotes Tfh cell polarization may have direct implications in the pathogenesis of AITL. To further explore additional oncogenic signals emanating from this mutant protein, and given the proposed role for TCR signaling as an oncogenic driver in the pathogenesis of PTCL (Warner et al., 2013), we analyzed the response of Rhoa G17V-expressing CD4+ T cells to TCR engagement. Towards this goal, we tested the proliferative response of control (vehicle-treated, Rhoaco-G17V/+;CD4CreERT2) and Rhoa G17V-expressing (4-hydroxytamoxifen-treated, RhoaG17V/+;CD4CreERT2) CD4+ T cells to stimulation with anti-CD3 plus anti-CD28 antibodies and with anti-CD3 antibody in the presence of iAPCs. These analyses revealed a marked increase in proliferation in Rhoa G17V-expressing CD4+ T cells compared with wild-type Rhoa-expressing controls (Figure 3A). Moreover, and consistent with an increased response to TCR signaling, we also observed increased expression of the T cell activation marker CD25 in Rhoa G17V-expressing CD4+ T cells treated with anti-CD3 antibody plus iAPCs (Figure 3B). To evaluate the effect of Rhoa G17V in CD4+ T cells proliferation in vivo, we labeled with Cell Trace Violet (CTV) and transplanted control WT (vehicle-treated, OT-II;Rhoaco-G17V/+;CD4CreERT2) or Rhoa G17V-expressing (4-hydroxytamoxifen-treated, OT-II;RhoaG17V/+;CD4CreERT2) sorted naive CD4+ T cells into Ly5.1+ C57BL/6 mice. Three days following NP-OVA-mediated immunization of recipient mice, OT-II;Rhoa G17V-expressing CD4+ T cells showed increased number of cell divisions as evaluated by CTV staining compared to wild-type Rhoa-expressing controls (Figure 3C) indicating that Rhoa G17V promotes increased TCR-driven proliferation in vivo.

Figure 3. Rhoa G17V expression increases CD4+ T cell proliferation.

Figure 3

(A) In vitro Cell Trace Violet (CTV) proliferation assay of CD4+ T cells isolated from Rhoaco-G17V/+;CD4CreERT2 mice, treated with vehicle alone (WT) or tamoxifen (Rhoa G17V) and stimulated with anti-CD3 (a-CD3) plus anti-CD28 (a-CD28) antibodies, or with anti-CD3 in the presence of iAPCs. (B) CD25 cell surface expression -measured by mean fluorescent intensity (MFI)- in WT and Rhoa G17V-expressing CD4+ T cells stimulated with increasing doses of anti-CD3 in the presence of iAPCs. (C) In vivo CTV proliferation flow cytometry analysis of WT and Rhoa G17V-expressing CD4+ T cells obtained from Ly5.1+ C57BL/6 mice transferred with CD4+ cells from OT-II;Rhoaco-G17V/+;CD4CreERT2 mice and assessed 3 days after immunization of recipients with NP-OVA in alum. Histograms are representative of two independent experiments (n=3). p values were calculated using a two-tailed Student’s t-test. Error bars, mean ± s.d. *p ≤ 0.05, **p ≤ 0.01. See also Figure S2.

Despite the predicted role of RHOA G17V as a dominant negative, the precise mechanism underlying the effect of RHOA G17V on proliferation and Tfh lineage specification is not fully understood. To explore the functional role of RHOA G17V on RHOA signaling, we treated control OT-II CD4+ T cells with the Clostridium botulinum C3 exoenzyme, a soluble toxin that ribosylates RHO-like proteins rendering them inactive. Treatment with C3 transferase induces a decrease in T cell activation in wild-type (WT) cells, which is consistent with the disruption of T cell activation in a conditional Rhoa knockout model (Yang et al., 2016). However, under the same conditions, expression of the Rhoa G17V allele (4-hydroxytamoxifen-treated, OT-II; RhoaG17V/+;CD4CreERT2) elicits increased CD25 expression, indicative of increased T cell activation (Figure S2).

RHOA G17V-expressing Tet2-null progenitors induce AITL in mice

TET2 loss-of-function mutations are initiating events in the pathogenesis of AITL frequently co-occurring with RHOA G17V as a second hit (Palomero et al., 2014;Sakata-Yanagimoto et al., 2014;Wang et al., 2015; Yoo et al., 2014). To test the oncogenic activity of RHOA G17V in promoting AITL in Tet2 deficient hematopoietic precursors, we infected bone marrow progenitors from wild-type and Tet2 knockout mice (Quivoron et al., 2011) with retroviruses expressing GFP, wild-type HA-tagged RHOA plus GFP (HA-RHOA-IRES GFP, abbreviated hereafter in the main text to RHOA for clarity) or mutant RHOA G17V plus GFP (HA-RHOA-IRES GFP, abbreviated hereafter in the main text to RHOA G17V for clarity) and evaluated their capacity to induce lymphoma upon transplantation into isogenic recipients (Figure S3A). In these experiments, mice transplanted with Tet2WT/WT progenitors did not develop any transplant-derived hematologic malignancies regardless of the expression of wild-type RHOA or mutant RHOA G17V. Mice transplanted with Tet2−/− hematopoietic progenitors infected with retroviruses expressing GFP alone or RHOA primarily developed myeloid malignancies and occasionally non-AITL-like lymphoproliferative disorders, a finding consistent with the previously observed tumor distribution in Tet2 knockout mice (Ko et al., 2011; Li et al., 2011; Moran-Crusio et al., 2011; Muto et al., 2014; Quivoron et al., 2011; Scourzic et al., 2016) (Figure S3B). In contrast, and most notably, mice transplanted with Tet2−/− bone marrow progenitor cells infected with RHOA G17V-expressing retroviruses developed lymphomas with a median survival of 12 months (Figure 4A and S3C). Histopathological examination of enlarged spleens and lymph nodes from deceased mice from this cohort with available tissues for analysis revealed diffuse splenic white pulp and paracortical lymph node lymphocytic infiltrates admixed with myeloid and histiocytic cells, expanded and disrupted follicular dendritic cell meshworks and increased high endothelial venule arborization, which are characteristic histopathologic features of AITL (Figure 4B and S3D). Sanger sequencing of tumor cDNA and RNA sequencing confirmed that these tumors expressed RHOA G17V transcripts at levels equivalent to the endogenous mouse wild-type Rhoa (Figure S3E and F). In addition, western blot analysis using anti HA antibodies confirmed the expression of the RHOA G17V protein (Figure S3G). Flow cytometry analyses of spleen and lymph nodes demonstrated the presence of Tet2−/− RHOA G17V-expressing transplant-derived GFP+ CD4+ T cells with Tfh-like features including expression of CXCR5, PD1, BCL6 and ICOS in all tumors analyzed from this cohort (Figures 4C and 4D). Sequencing analysis of the TCR repertoire in Tet2−/− RHOA G17V-induced lymphomas revealed the presence of monoclonal T cell populations in all cases analyzed (Figure 4E). Moreover, RNA-Seq gene expression profiling of sorted GFP+ Tet2−/− RHOA G17V-expressing tumor cells showed increased expression of genes characteristically associated with human AITL (de Leval et al., 2007) and a significant enrichment of Tfh signature genes (Chtanova et al., 2004) (Figure 4F and Figure S4A). More importantly, the Tet2−/− RHOA G17V CD4+ tumor cells display functional characteristics of bona fide Tfh cells. Thus, in vitro co-culture of Tet2−/− RHOA G17V tumor cells with isolated CD19+ B cells led to enhanced B cell activation and immunoglobulin production similar to that induced by normal Tfh cells (Figure S4B and C).

Figure 4. RHOA G17V expression in Tet2−/− hematopoietic progenitors induces AITL–like lymphomas in mice.

Figure 4

(A) Kaplan-Meier survival curve of mice transplanted with Tet2−/− bone marrow progenitors infected with retroviruses expressing HA-RHOA G17V plus GFP. (B) Histological micrographs of representative lymph node and spleen tissues obtained from diseased mice transplanted with Tet2−/− hematopoietic progenitors infected with retroviruses expressing HA-RHOA G17V plus GFP. Images are depicted at two different magnifications as indicated by scale bars. (C) Representative FACS plot showing CD4 expression in Tet2−/− RHOA G17V-expressing GFP+ spleen tumor cells. The percent of CD4+ GFP+ cells is indicated in the upper quadrant (D) Flow cytometry analysis of the expression of CXCR5, PD1, BCL6 and ICOS Tfh cell markers gated in the CD4+GFP+ spleen tumor cells from (C). (E) Tcrb gene clonal analysis in three independent Tet2−/− RHOA G17V-expressing GFP+ tumors. Sectors represent the percentage of reads corresponding to individual Tcrb sequences. (F). GSEA analysis of differentially expressed genes associated with Tet2−/− RHOA G17V-expressing GFP+ mouse tumors. AITL geneset: top differentially upregulated genes in AITL compared with PTCL not otherwise specified (PTCL, NOS) (fold change 1.5, p <0.002) (de Leval et al., 2007). Tfh geneset: top 100 genes associated with Tfh cells (Chtanova et al., 2004). Data set: upregulated genes in Tet2−/− RHOA G17V AITL-like lymphomas compared with T-ALL. Enrichment plots and heat map representation of top 25 ranking genes in the leading edge are shown. Genes in heat maps are shown in rows, and each individual sample is shown in one column. The scale bar shows color-coded differential expression from the mean in s.d. units, with red indicating higher expression and blue indicating lower expression. Images are shown at two different magnifications as indicated by scale bars. See also Figures S3, S4 and S5.

Transplantation of Tet2−/− RHOA G17V-expressing tumor cells into secondary recipients led to accelerated development of AITL (Figure S5A), which retained many of the histopathological features of the original tumor including PD1 expression and the presence of expanded follicular dendritic cell meshworks and vascular endothelial cells (Figure S5B and C); as well as the characteristic Tfh-like immunophenotype (Figure S5D and E) and clonal Tcrb rearrangement identical to that detected in the primary lymphoma (Fig S5F). In addition, mice injected with Tet2−/− RHOA G17V tumor cells presented increased serum levels of the inflammatory cytokines IL6 and TNFA and increased levels of VEGFA, a growth factor characteristically associated with AITL lymphomas (Figure S5G and H).

To further evaluate the cooperative role of Tet2 loss and Rhoa G17V mutation in AITL lymphomagenesis we transplanted bone marrow progenitor cells from Rhoaco-G17V/+;Tet2f/f; CD4CreERT2 mice into lethally irradiated C57Bl/6 recipient mice and after 6 weeks to allow for hematopoietic reconstitution, we treated them with vehicle (control cohort; n=10) or tamoxifen (experimental cohort; n=10) to induce the expression of the Rhoa G17V mutant allele. Mice in both control and experimental cohorts were immunized every 3 weeks with sheep red blood cells (SRBC) to induce T cell activation and germinal center formation. Analysis of CD4+ T cells in peripheral blood six weeks after tamoxifen treatment identified increased numbers of Tfh cells in mice transplanted with Rhoaco-G17V/+;Tet2f/f ;CD4CreERT2 and treated with tamoxifen compared with vehicle treated controls (p=0.0008) (Figure 5A). At 26 weeks post transplantation, 7/10 mice in the RhoaG17V/+;Tet2−/−;CD4CreERT2 cohort were euthanized due to disease development, with a median survival of 175 days (p=0.001) (Figure 5B). Flow cytometry analysis of T cell populations in diseased mice showed expansion of the CXCR5+ Pd1+ Tfh compartment in spleen and bone marrow, accompanied by increased expression of BCL6 and ICOS (Figure 5C). Moreover, analysis of TCRB expression in Tfh populations showed evidence of clonal expansions restricted to the Tfh compartment (Figure 5D) while histological analysis of lymph nodes and spleen demonstrated severe disruption of the splenic architecture and characteristic features of AITL, including prominent proliferation of follicular dendritic cells and increased vascularity (Figure 5Eand F ).

Figure 5. CD4 T cell specific expression of Rhoa G17V induces Tfh differentiation and cooperates with Tet2 loss in the generation of AITL–like lymphomas in mice.

Figure 5

(A) Analysis of CXCR5+ CD4+ T cells in peripheral blood of mice transplanted with bone marrow cells from Rhoaco-G17V/+;Tet2f/f;CD4CreERT2 mice and treated with vehicle (n=10) or tamoxifen (TMX) (n=10). (B) Kaplan-Meier survival curve of animals transplanted with bone marrow progenitor cells from Rhoaco-G17V/+;Tet2f/f;CD4CreERT2 mice treated with vehicle only or tamoxifen (n=10 mice per group). Tamoxifen administration and serial sheep red blood cells (SRBC) immunizations are indicated by arrows in the timeline (red: tamoxifen; black: SRBC). (C) Flow cytometry analysis of Tfh cell markers in spleen and bone marrow cells from diseased tamoxifen-treated mice: CXCR5, PD1 FACS plot (upper panel), BCL6 and ICOS histograms (lower panel). (D) Pie chart representation of the results of Tcr Vβ clonality analysis by flow cytometry on spleen samples from diseased tamoxifen-treated animals. Three representative tumors are depicted. (E) Histological micrographs of representative lymph node and spleen tissues obtained from diseased tamoxifen-treated mice (F) Immunohistochemical analysis of the expression of CD4, PD1, PAX5, B220, CD21 and CD31 in spleen sections from tamoxifen-treated tumor affected mice. p values were calculated with two-tailed Student’s t-test. ***p ≤ 0.001.

In all, these results support a driver oncogenic role for RHOA G17V in cooperation with Tet2 loss in the pathogenesis of AITL.

AITL tumor proliferation is dependent on ICOS signaling

The marked association of the RHOA G17V mutation with AITL in humans and in our mouse lymphoma model suggests a close link between signaling pathways implicated in Tfh cell proliferation and survival and those responsible for RHOA G17V-induced T cell transformation. To further explore the requirement of TCR signaling for proliferation of RHOA G17V–expressing lymphoma cells, we studied their response to treatment with increasing concentrations of anti-CD3 antibody plus iAPCs. In these in vitro experiments, we verified that mouse control naive CD4+ T cells require the simultaneous presence of both stimuli, and their proliferation depends on the strength of TCR activation (Figure 6A). In contrast, Tet2−/− RHOA G17V-expressing AITL-like tumor cells showed strong iAPC-induced proliferation even in the absence of TCR activation. Of note, and despite surface expression of CD3 and TCRA/B (Figure 6B), this proliferative response was dependent on iAPC signaling as engagement of the CD3 receptor with increased concentrations of anti-CD3 antibody failed to further enhance proliferation (Figure 6A). Consistently, Tet2−/− RHOA G17V-expressing AITL-like tumor cells, which showed limited cell proliferation in vitro, effectively expanded in vivo in the absence of antigen stimulation, while control wild-type CD4+ T cells failed to proliferate under these conditions (Figure 6C). These results indicate that iAPC cell extrinsic signals promote the growth of Tet2−/− RHOA G17V-expressing AITL cells in vivo. Notably, and of potential relevance as cells extrinsic driver of proliferation, analysis of CD21+ follicular dendritic cells; CD11b+ GR1+ dendritic cells and B220+ B cells from mouse Tet2−/− RHOA G17V lymphomas demonstrated high levels of expression of ICOSL (Figure S6). In this context, we postulated that given the high level of ICOS expression present in Tet2−/− RHOA G17V-expressing lymphoma cells (Figures 4D and 5C) ICOS signaling could drive the proliferation of RHOA G17V-induced tumors. Consistent with this possibility, analysis of signaling pathways in Tet2−/− RHOA G17V-expressing lymphomas showed high levels of ERK1/2, AKT and ribosomal S6 protein phosphorylation suggestive of ICOS-mediated activation of MAPK and PI3K signaling pathways (Figure 7A). Moreover, ICOS activation in Tet2−/− RHOA G17V–expressing tumor cells using an anti-ICOS antibody increased S6, ERK1/2 and AKT phosphorylation demonstrating enhanced MAPK and PI3K pathway activation (Figure 7Ba) while in contrast, engagement of the T cell receptor with anti-CD3 and anti-CD28 antibodies failed to activate these pathways (Figure 7B).

Figure 6. Tet2−/− RHOA G17V-expressing GFP+ mouse tumor cells proliferate in TCR-independent way.

Figure 6

(A) Histograms corresponding to flow cytometry in vitro proliferation analysis using CTV staining in Tet2−/− RHOA G17V and control CD4+ T cells under basal conditions and upon stimulation with increasing doses of anti-CD3 antibody and iAPCs. (B) Flow cytometry analysis of the expression of surface CD3 and TCRA/B in Tet2−/− RHOA G17V tumor cells from secondary AITL recipient mice. (C) Flow cytometry in vivo proliferation analysis of CTV-stained Tet2−/− RHOA G17V GFP+ tumor cells and control CD4+ T cells isolated from spleen 4 days after their injection in non-immunized mice. See also Figure S6.

Figure 7. ICOS induces activation of MAPK and PI3K pathways in Tet2−/− RHOA G17V-expressing GFP+ tumor cells.

Figure 7

(A) Flow cytometry analysis of MAPK (pERK1/2) and PI3K (pAKT and pS6) signaling in Tet2−/− RHOA G17V-expressing GFP+ spleen tumor cells compared to CD4+ T cell controls. (B) Flow cytometry analysis of S6, ERK1/2 and AKT phosphorylation in Tet2−/− RHOA G17V-expressing GFP+ CD4+ tumor cells following stimulation with antibodies against CD3, CD28 and ICOS or an isotype antibody control (IgG and shadow histograms). Data are representative of at least three independent experiments.

To evaluate the effects of inhibiting ICOS signaling on the growth of mouse AITL tumors in vivo, we transplanted mice with Tet2−/− RHOA G17V–expressing lymphoma cells and treated these animals with an anti-ICOS-ligand blocking antibody (a-ICOSL) (Figure S7A). Inhibition of ICOS effectively decreased tumor cell proliferation (Figure 8A) and reduced ICOS-mediated PI3K activation (Figure 8B) compared with isotype antibody treatment controls. In addition, and most notably, sustained inhibition of ICOS activation in this model decreased lymphoma progression as documented by reduced spleen weight and tumor infiltration in spleen (Figures 8C and D) and peripheral organs (Figure 8E). In addition and consistent with the role of PI3K as an important mediator of ICOS signaling, treatment with duvelisib (Figures S8B and C), a selective small molecule PI3K δ/γ inhibitor, blocked tumor cell proliferation in vivo (Figure 8F) and induced strong anti-tumor activity in Tet2−/− RHOA G17V lymphoma bearing mice in vivo with significant reductions in tumor burden associated with decreased tumor cell proliferation and increased apoptosis (Figures 8G–J and Figure S7D).

Figure 8. ICOS-PI3K signaling is critical for cell proliferation in Tet2−/− RHOA G17V AITL-like mouse lymphomas.

Figure 8

(A) Representative histogram and associated quantification of in vivo CTV proliferation analysis by flow cytometry of Tet2−/− RHOA G17V-expressing GFP+ spleen tumor cells isolated from transplanted recipient mice 4 days after treatment with an anti-ICOSL blocking antibody or an IgG isotype control (n=3). (B) Representative plot and associated quantification of in vivo S6 phosphorylation measured by flow cytometry in Tet2−/− RHOA G17V-expressing GFP+ spleen tumor cells isolated from transplanted recipient mice 4 days after treatment with an anti-ICOSL blocking antibody or an IgG isotype control (n=3). (C) Quantification of spleen weight in a cohort of mice transplanted with Tet2−/− RHOA G17V-expressing GFP+ tumors 15 days after treatment with an anti-ICOSL blocking antibody (n=5) or an IgG isotype control (n=5). Each symbol represents an individual mouse. Horizontal bars indicate mean values. (D) Quantification of tumor load (CD4+GFP+ cells) in spleen from mice transplanted with Tet2−/− RHOA G17V-expressing GFP+ tumors 15 days after treatment with an anti-ICOSL blocking antibody (n=5) or an IgG isotype control (n=5). (E) Representative histological micrographs of formalin-fixed, hematoxylin-eosin stained lung, liver and kidney sections obtained from Tet2−/− RHOA G17V-expressing GFP+ tumor-bearing mice treated with an anti-ICOSL blocking antibody or IgG1 isotype control. (F) Representative flow cytometry plot and associated quantification of CTV in vivo proliferation analysis of Tet2−/− RHOA G17V tumor cells isolated from spleens from transplanted recipient mice 4 days after tumor injection and after treatment with vehicle only or duvelisib (50 mg kg−1) (n=3). (G) Quantification of spleen weight in mice transplanted with Tet2−/− RHOA G17V-expressing GFP+ LUC+ tumor cells after treatment with vehicle only or duvelisib (100 mg kg−1) (n=10). (H) Quantitative luminescence analysis of tumor burden performed in mice from (G). The effect of the drug was assessed 21 days after tumor injection. (I and J) Representative immunohistochemistry images showing expression of the proliferation marker Ki67 (I) and cleaved caspase-3 (J) in formalin-fixed spleen sections from Tet2−/− RHOA G17V tumor-bearing mice treated with vehicle only or duvelisib (100 mg kg−1) for 21 days. Scale bars values are indicated. Data in A, B, C and D are representative of at least three independent experiments. n indicates the number of animals per group used in each experimental setting. p values were calculated using a two-tailed Student’s t-test. Error bars, mean ± s.d. **p ≤ 0.01, ***p ≤ 0.001. See also Figure S7.

Collectively, these results demonstrate that Tet2−/− RHOA G17V tumor cell proliferation is dependent on the activation of ICOS-PI3K-mTOR signaling and support a potential therapeutic role for drugs targeting this pathway for the treatment of AITL.

DISCUSSION

Tfh cells are a specialized subset of CD4+ T cells that migrate into germinal centers (GC) to provide help to GC B cells via costimulatory receptors and secretion of cytokines (Crotty, 2015). The development of Tfh cells in the germinal center requires a coordinated series of signaling events and activation of specific transcriptional regulators, which together orchestrate the acquisition of a Tfh cell fate from naive CD4+ T cells. One of the earliest events during Tfh differentiation is the upregulation of the CXCR5 chemokine receptor (Yu et al., 2009). If upon initial interactions with dendritic antigen presenting cells CXCR5 is expressed, then this early "primed" Tfh cell will migrate to the border of the B cell follicle facilitating cell-cell interactions with developing B cells within the germinal center, which leads to further progression of Tfh cell differentiation (Crotty, 2014). Along the entire differentiation process, the BCL6 repressor is the defining transcription factor determining Tfh cell fate. BCL6 target genes in Tfh cells are highly enriched in genes involved on cell migration and in genes associated with specification of non-Tfh helper cell lineages, including Th1, Th2, Th17 and Treg, indicating a particularly important role of BCL6 in suppressing alternative T-helper fates (Hatzi et al., 2015). In this process, extracellular signals transduced from the ICOS coreceptor are especially critical for proper Tfh cell differentiation and function (Choi et al., 2011;Stone et al., 2015; Weber et al., 2015). Indeed, the sanroque mouse model, which carries a mutant form of the Roquin-1 RNA-binding protein causing defective mRNA decay-induced ICOS downregulation, shows increased spontaneous germinal center formation and increased number of Tfh cells, supporting an instructive role for ICOS signaling in Tfh development (Heissmeyer and Vogel, 2013; Yu et al., 2007). Therefore, disruption of these intricate ICOS-mediated pathways could also affect as well the development of Tfh-associated malignancies such as AITL as demonstrated here.

Functional characterization of genes targeted by lymphoma-associated genetic lesions has provided significant insight into the mechanisms governing the development and function of normal lymphoid populations as well as the pathobiology of these diseases (Jiang et al., 2017). In this context, the close relationship between AITL tumor lymphocytes and Tfh cells implies that genes that are deregulated in AITL are likely relevant for normal Tfh development and function. Conversely, Tfh differentiation and proliferation pathways may provide important growth and survival cues contributing to the pathogenesis of AITL.

Genetically, AITL is characterized by high prevalence of the RHOA G17V mutation, which frequently occurs in association with epigenetic-disrupting mutations in TET2, DNMT3A and IDH2 (Palomero et al., 2014; Sakata-Yanagimoto et al., 2014; Yoo et al., 2014). Expression of Rhoa G17V in CD4+ T cells significantly increases differentiation towards the Tfh lineage, as documented by increased numbers of CD4+ CXCR5+ PD1+ cells, suggesting an instructive role for this mutation in the establishment of the Tfh features characteristic of AITL.

In addition, our data reveals a potentially important relationship between RHOA and ICOS signaling pathways during Tfh differentiation. Tfh lineage differentiation in CD4+ T cells expressing the Rhoa G17V mutation is mediated by an ICOS dependent mechanism. Interestingly, the increase in Treg cells, including Tfr populations, is also dependent on ICOS expression (Burmeister et al., 2008). Of note, Rhoa G17V-expressing Tfh cells show high levels of expression of the ICOS coreceptor and demonstrate enhanced ICOS signaling and consequent increased proliferation and pro-inflammatory cytokine secretion upon ICOS activation. Reciprocally, it has been shown that acute ligation of ICOS without TCR co-engagement leads to activation of the RHOA and CDC42 small GTPases, which is consistent with the role of ICOS signaling in promoting actin cytoskeleton remodeling (Leconte et al., 2016).

While RHOA G17V has been shown to play a dominant negative role on RHOA signaling in biochemical and cellular assays by sequestering RHOA GEF proteins (Palomero et al., 2014; Sakata-Yanagimoto et al., 2014; Yoo et al., 2014), the precise mechanisms underlying the its effect on T cell proliferation, Tfh lineage specification and transformation remain to be fully defined.

Transcriptional and genomic profiling studies have established a close relationship between AITL and Tfh cells (de Leval et al., 2007; Piccaluga et al., 2007) and support a cooperative role for the RHOA G17V mutation and epigenetic deregulation in the pathogenesis of AITL (Palomero et al., 2014; Sakata-Yanagimoto et al., 2014; Yoo et al., 2014). Yet, the lack of models that accurately recapitulate the natural history of the disease has limited our understanding of the molecular mechanisms leading to AITL transformation. Our results demonstrate that expression of RHOA G17V in a Tet2−/− background specifically results in the development of CD4+ T cell mouse lymphomas that fully recapitulate the clinical, histologic, cellular and transcriptional features associated with AITL, including the presence of Tfh specific markers. This finding suggests a cooperative effect of Tet2 loss and RHOA G17V in human AITL transformation. Notably, TET2 alterations have been shown to occur at an early stage of hematopoietic cell differentiation, as these mutations have been found in nonmalignant hematopoietic cells of several AITL cases and in normal elderly individuals with clonal hematopoiesis (Couronne et al., 2012; Quivoron et al., 2011; Sakata-Yanagimoto et al., 2014; Xie et al., 2014). In contrast, analysis of allelic frequency and somatic status characterize the RHOA G17V mutation as a second hit occurring at a later point in lymphomagenesis (Iqbal et al., 2015). Based on these findings and the results of our animal models we propose a multistep model for AITL development in which early TET2 mutations establish a premalignant pluripotent clone first and then the acquisition of a secondary RHOA G17V mutation steers T cell development towards the Tfh lineage, leading to the specific development of AITL.

Normal T cells express a unique antigen receptor that recognizes peptides bound to major histocompatibility complex (MHC) proteins. Specific TCR-mediated antigen recognition leads to the activation of multiple growth and survival pathways. With a few notable exceptions, expression of the TCR is maintained in most T cell lymphomas suggesting that it is important for T cell lymphomagenesis (Warner et al., 2013). Interestingly, we found that Tet2−/− RHOA G17V lymphoma cells strongly proliferate in a TCR-independent fashion despite high levels of CD3 expression. Instead, tumor proliferation depends on a stimulatory signal provided by engagement of the ICOS coreceptor that leads to increased activation of the PI3K-mTOR signaling pathway. ICOS is highly expressed both on normal Tfh and AITL lymphoma cells and its signaling is initiated upon engagement by its only known ligand, ICOSL, which is expressed by B cells, activated monocytes and dendritic cells (Aicher et al., 2000). Pharmacologic and genetic experiments demonstrate that PI3K is a key mediator of ICOS-dependent T cell differentiation, proliferation and effector functions, particularly in CD4+ T cells (Gigoux et al., 2009). Here we demonstrate that the ICOS-PI3K axis is important for both Rhoa G17V-induced Tfh cell differentiation and RHOA G17V–induced AITL development in support of targeted therapies directed towards this signaling pathway for the treatment for AITL.

In summary, we have established that RHOA G17V acts as a lineage specification factor that it is likely crucial for human AITL development and generated mouse lymphoma models with histological, transcriptional and immunophenotypic features similar to those of human AITL. These models will be instrumental for the preclinical testing of therapies for the treatment of this devastating disease.

EXPERIMENTAL PROCEDURES

Contact for Reagent and Resource Sharing

Further information and requests for resources and reagents should be directed to and will be fulfilled according to institutional rules by the Lead Contact, Teresa Palomero (tp2151@columbia.edu).

Experimental Model and Subject Details

Mice

We maintained all animals in filter-topped cages on autoclaved food and water in specific pathogen-free facilities at the Irving Cancer Research Center at Columbia University Medical Center campus. All animal procedures were approved by the Institutional Animal Care and Use Committee (IACUC) at Columbia University Medical Center (Protocol #AAAS4466). The Rhoaco-G17V/+ conditional knock-in mouse line was generated at Ingenious Targeting Laboratory (Ronkonkoma, NY). The Tetf/f mouse line was generously provided by Dr Ross Levine at MSKCC (New York, NY) (Moran-Crusio et al., 2011). Briefly, Rhoa exon 3 was replaced with a minigene containing Rhoa exons 3 to 6 flanked by loxP sites followed by a neomycin selection cassette and a mutant Rhoa exon 3 encoding the G17V substitution. CD4CreERT2 line (Tg(Cd4-cre/ERT2)11Gnri) mice, which expresses a tamoxifen-inducible form of the Cre recombinase under the control of the mouse Cd4 promoter (Aghajani et al., 2012), were purchased from Jackson Laboratories (Bar Harbor, ME). OT-II (B6.Cg-Tg(TcraTcrb)425Cbn/J) and Ly5.1+ (CD45.1) C57BL/6 mice were purchased from Jackson Laboratories (Bar Harbor, ME) and Rag2/Il2rg double knockout mice (B10;B6-Rag2tm1Fwa Il2rgtm1Wjl) were purchased from Taconic Biosciences (Rensselaer, NY). We bred Rhoa G17V conditional knock-in mice with CD4CreERT2 line to generate conditional inducible CD4 specific Rhoa G17V mice (Rhoaco-G17V/+;CD4CreERT2). Rhoaco-G17V/+;CD4CreERT2 mice were bred with OT-II mice to generate OT-II;Rhoaco-G17V/+;CD4CreERT2 or with Tet2f/f; CD4CreERT2 to generate Rhoaco-G17V/+;Tet2f/f;CD4CreERT2. Age- and sex-matched male and female mice of each genotype were used in experiments in which different genotypes were compared. For drug treatment and tumor transplant studies, age-matched female mice were randomly assigned to different treatment groups.

Cell lines

The human fetal embryonic kidney cell line HEK293T (ATCC® CRL-1573TM) (source: female) was purchased from American Tissue Culture Collection (ATCC) and cultured under standard conditions in DMEM media supplemented with 10% fetal bovine serum, 100 U ml−1 penicillin G and 100 μg/ml streptomycin at 37°C in a humidified atmospher e under 5% CO2. The human Jurkat T-cell lymphoblastic leukemia cell line, clone E6-1 (ATCC® TIB-152TM) (source: male) was obtained from the ATCC and grown in RPMI1640 media containing 10% FBS, 100 Uml−1 penicillin G and 100 μg/ml streptomycin at 37°C in a humidified atmospher e under 5% CO2. Cell line identity was regularly tested by genetic profiling using polymorphic short tandem repeat loci.

Source and culturing conditions for the primary cells used in this manuscript are detailed in the Methods section.

Method Details

Adoptive transfer

CD4+ T cells isolated from OT-II;Rhoaco-G17V/+;CD4CreERT2 mice were transferred into 6 to 8 week-old Ly5.1+ C57BL/6 female recipients by retro-orbital injection. We immunized the recipient mice by standard foot pad immunization using 50 μg NP14-OVA (Biosearch Technologies) precipitated in alum adjuvant (Pierce).

Bone Marrow Transplant

We harvested bone marrow cells from the long bones of WT and Tet2−/− mice (Quivoron et al., 2011). We isolated lineage negative cells using a magnetic bead-based, negative selection cell lineage depletion kit (Miltenyi, Cat. No. 130-090-858) following manufacturer’s guidelines. We infected lineage negative cells by spinoculation with viral particles generated with retroviral vectors containing GFP only (pMSCV IRES GFP); HA-RHOA plus GFP (pMSCV HA-RHOA IRES GFP); or RHOA G17V plus GFP (pMSCV HA-RHOA G17V IRES GFP). We transplanted 105 GFP+ cells via retro-orbital injection into lethally irradiated 6 to 8 week-old C57BL/6 female mice.

Tumor Transplantation

We injected cell suspensions containing ×ばつ106 million cells isolated from lymphoma-infiltrated bone marrow or tumor containing spleen from diseased mice into immunodeficient 6 to 8 week-old female Rag2/Il2rg double knockout mice using retroorbital injection.

In vivo induction of RHOA G17V expression

For in vivo induction of Rhoa G17V expression in CD4+ T cells, Rhoaco-G17V/+;CD4CreERT2 mice were treated with a single dose of tamoxifen (3 mg) (Sigma, T5648) dissolved in corn oil and administered via intraperitoneal injection. Analysis of the distribution and characteristics of T-cell populations in response to the expression of the Rhoa G17V mutant allele was performed 14 days after tamoxifen treatment.

Lymphoma development

For analysis of lymphoma development, we injected ×ばつ106 total bone marrow cells obtained from Rhoaco-G17V/+;Tet2f/f;CD4CreERT2 mice into lethally irradiated 6 to 8 week-old female C57BL/6 mice. 6 weeks post-transplantation, mice were treated with a single dose of 3 mg of tamoxifen to induce Rhoa G17V expression and Tet2 deletion in CD4+ T cells. To generate germinal center responses and T cell activation, mice were immunized with ×ばつ109 sheep red blood cells (SRBC; Cocalico Biologicals, Inc.) delivered by intraperitoneal injection every 3–4 weeks.

In vivo pharmacological treatments

To test the effect of PI3K inhibition in tumor cell proliferation, we used Duvesilib, a double PI3Kδ and PI3Kγ inhibitor, from Advanced ChemBlocks, Inc. (H-8738). Duvelisib was dissolved in a solution containing 5% DMSO and 30% PEG 400 in phosphate buffered saline (PBS) and administered intraperitoneally for three consecutive days at a dose of 50 mg kg−1. For the analysis of the role of PI3K inhibition in tumor development, animals were injected with cell suspensions containing ×ばつ106 million Tet2−/− RHOA G17V GFP+ LUC+ tumor cells via retroorbital injection. At day seven post-transplant, we assessed tumor development by measuring tumor-derived luciferase activity in vivo using the In Vivo Imaging System (IVIS, Xenogen). Animals presenting homogeneous tumor burden were randomly assigned to two treatment cohorts, vehicle only or duvelisib with n=8 animals/group. Duvelisib (100 mg kg−1) was administered intraperitoneally for three consecutive days with one day off in between series to the drug treatment cohort, starting the day after the initial tumor load quantification. The effect of duvelisib on overall tumor burden was assessed by bioimaging at day 21 post-transplant followed by quantification of spleen weight after euthanasia. For blocking ICOS signaling in vivo through inhibition of the interaction of the ICOS receptor with its ligand, we injected 100 μg of anti-ICOSL (Clone: HK5.3, BioXCell) antibodies or isotype control (2A3, BioXCell) via intraperitoneal every other day (see detailed administration protocol in Figure S7).

Plasmid constructs

We obtained the pcDNA3-EGFP-Rhoa-wt RHOA cDNA expression vector from Addgene (#12965) and introduced the p.Gly17Val (G17V) mutation by site-directed mutagenesis using the QuikChange II XL Site-Directed Mutagenesis Kit (Stratagene, Cat. No. 200522). We subsequently introduced an HA N-terminal tag by PCR amplification and cloned the resulting HA-RHOA and HA-RHOA G17V sequences in the pMSCV IRES GFP retroviral vector (Palomero et al., 2014).

Retroviral and lentiviral production and infection

To generate infectious retroviral particles, we transfected the retroviral constructs pMSCV IRES GFP, pMSCV HA-RHOA WT IRES GFP and pMSCV HA-RHOA G17V IRES GFP together with the pMCV-ecopac packaging vector (Finer et al., 1994) into HEK293T cells using the JetPEI transfection reagent (Polyplus). We harvested viral supernatants at 48 hr and 72 hr after transfection and used them for infection of mouse bone marrow lineage negative progenitor cells by double spinoculation on consecutive days. To produce lentiviral particles, we transfected HEK293T with the FUW-mCherry-Puro-Luc lentiviral vector together with plasmid vectors encoding the Gag-Pol (pCMV ΔR8.91) and V-SVG (pMD.G VSVG) viral proteins. Lentiviral particles were harvested from cell culture supernatant and infection of Tet2−/− RHOA G17V tumor cells was performed as described above.

CD4+ T cell isolation, primary culture and activation

To isolate mouse CD4+ cells, single-cell suspensions were prepared from spleen and/or lymph nodes using standard procedures. Males and females were used for this experiment. CD4+ naive T cells were then harvested by negative selection using the mouse naive CD4+ T cell Isolation Kit (Milteny, Cat. No. 130-104-453) according to the manufacturer’s protocol. CD4+ cells were cultured in RPMI1640 media containing 10% FBS, glutamine and 2-Mercaptoethanol and supplemented with specific cytokines as detailed below depending on the focus of the experiment. To induce the expression of the Rhoa G17V mutant allele in vitro, naive CD4+ T cells isolated from Rhoaco-G17V/+;CD4CreERT2 mice were treated with vehicle or 4-hydroxytamoxifen (Santa Cruz Biotechnology, sc-3542) for 48 hr in RPMI1640 media supplemented with 10% FBS and 20 ng mL−1 IL-7. To assess cell proliferation, vehicle and 4-hydroxytamoxifen treated cells were washed in PBS and activated by culturing them on plates coated with anti-CD3 (clone 145-2C11, BD Biosciences) and media supplemented with soluble anti-CD28 (clone 37.5B, BD Biosciences) antibodies and irradiated T cell–depleted splenocytes as co-stimulator cells (irradiated antigen presenting cells, iAPCs) when indicated. T cell proliferation was measured by flow cytometry on cells stained with Cell Trace Violet (CTV) (Life Technologies, C34557) following standard procedures. To induce Tfh differentiation in vitro, naive CD4+ T cells were co-cultured with iAPCs on anti-CD3 coated plates using RPMI media supplemented with 25 ng mL−1 IL-6 (Peprotech), 50 ng mL−1 IL-21 (Peprotech), 4 ng mL−1 anti-IFNG (500-P119, Peprotech), 4 μg mL−1 anti-IL-4 (500-P54, Peprotech) and 20 μg mL−1 anti-TGFB (1D11, R&D Systems). To analyze the consequences of RHOA inhibition in T cell activation, naive CD4+ T cells isolated from OT-II; Rhoaco-G17V/+;CD4CreERT2 mice were treated with the exoenzyme C3 transferase (4 μg mL−1) for 4 hr and then activated with iAPCs loaded with OVA323–339 peptide for an additional 12 hr.

To study the role of RHOA on ICOS signaling, we estimulated vehicle- or 4-hydroxytamoxifen-treated naive CD4+ T cells with anti-CD3 and anti-CD28 antibodies for 48 hr as described above to induce comparable levels of ICOS expression. Cells were then re-stimulated with soluble anti-CD3 (1 μg ml−1) and anti-ICOS (1 μg ml−1) (clone C398.4A, eBioscience); together with anti–Armenian Hamster IgG F(ab′)2 (20 μg/mL) IgG crosslinking antibody (Jackson ImmunoResearch). Cell activation was arrested by fixation with 4% formaldehyde and cells were permeabilized with 90% ice cold methanol for immunostaining analysis by flow cytometry. To characterize the functional role of Rhoa G17V-expressing Tfh and AITL tumor cells on the induction of B cell responses, sorted naive CD4+ or Tfh cells from OT-II;Rhoaco-G17V/+;CD4CreERT2 mice or Tet2−/− RHOA G17V tumor cells were co-cultured with anti-IgM stimulated B cells and OVA323–339 peptide in 96 well U-bottom plates for 96 hr. B cell activation was analyzed by measuring the level of CD86 up-regulation by flow cytometry under the different conditions. At the end of the experiment, cell culture supernatants were collected and total IgG production was analyzed by ELISA using the mouse IgG total Ready-SET-Go! Kit (eBiosciences) according to manufacturer protocol.

Antibody staining and flow cytometry analysis

We stained single cell suspensions following standard procedures using fluorochrome-conjugated antibodies supplied by eBiosciences and directed against CD3 (145-2C11), TCRA/B (H57-597), CD4 (RM4-5), CD8a (53-6.7), PD1 (J43), ICOS (C398.4A), CD25 (7D4), CD69 (H1.2F3), CD86 (B7-2) (GL1), Ly-6G (Gr-1) (RB6-8C5), CD11b (M1/70), CD19 (1D3), ICOSL (HK5.3), BCL6 (K112-91) and FOXP3 (150D/E4). The antibody against CD45R (B220) (RA3-6B2) is from Miltenyi and the anti-IFNG (XMG1.2) was purchased from BD Biosciences. For detection of CXCR5, we used purified anti-CXCR5 antibody (2G8) from BD Biosciences and followed a three-step staining protocol as previously described (Johnston et al., 2009). Intracellular detection of BCL6 and FOXP3 were performed under standard conditions using the FOXP3 transcription factor staining buffer (eBiosciences) as directed by the manufacturer’s protocol. For flow cytometry detection of phosphorylated intracellular proteins, cells were fixed with 4% formaldehyde and permeabilized with 90% ice cold methanol and then incubated with phosphor-ERK (197G2), phosphor-AKT (D9EXP) and phosphor-S6 rabbit antibodies (D68F8) followed by secondary antibody staining using an anti-rabbit Alexa-647 antibody, all supplied by Cell Signaling. We acquired flow cytometry data using a FACS Canto cytometer (BD Biosciences) and analyzed them using FlowJo software (TreeStar).

RNA and DNA isolation

Total RNA was extracted by guanidinium thiocyanatephenol-chloroform extraction (TriZol) and purified using RNeasy Mini kit (QIAGEN, Cat. No. 74106) following the manufacturer’s protocol with some modifications. Briefly, 100% ethanol was added to TriZol lysates, vortexed and applied to QIAGEN RNeasy Mini spin column. The column was washed with QIAGEN buffer RW1 and on-column DNase treatment was performed (RNase-Free DNase Set, QIAGEN Cat. No. 79254). The filter was subsequently washed with QIAGEN buffers RW1 and RPE and 80% ethanol and the RNA was eluted with RNase-free water.

DNA was isolated using the DNeasy Blood & Tissue Kit (QIAGEN, Cat. No. 69506) following the manufacturer’s instructions.

cDNA synthesis

cDNA synthesis from RNA was performed using random primers and the SuperScript II Reverse Transcriptase Kit (Invitrogen, Cat. No.18064) following manufacturer’s protocol.

PCR amplification and Sanger sequencing

Expression of the HA-RHOA G17V mutant allele was detected in Tet2−/− RHOA G17V tumor cells by PCR amplification using the KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, KK2601) and the following primers: HA_RHOA_fw ATACGATGTTCCAGATTACGCT and HA_RHOA_rv GCCTCAGGCGATCATAATCTT followed by Sanger sequencing performed at Genewiz (South Plainfield, NJ). Expression of Rhoa G17V in vehicle and 4-hydroxytamoxifen-treated mouse CD4+ CD4CreERT2 Rhoa G17V T cells was detected using the primers Rhoa_fw ATGGCTGCCATCAGGAAGAAAC and Rhoa_rv GCTTCCCATCCACCTCGATATC as described above.

Western blot analysis

Western blot analysis was performed on tissue or cell lysates separated by SDS-PAGE and transferred to nitrocellulose membranes using standard procedures. For immunoblot detection, we used the following antibodies: Rhoa (67B9) (dilution 1:2,000) (Cell Signaling Technology, Cat. No. 2117), HA (dilution 1:1,000) (Roche, Cat. No. 11867423001) or GAPDH (D16H11) (dilution 1:8,000) (Cell Signaling Technology, Cat. No. 5174). The blots were developed with SuperSignalTM West Dura Extended Duration Substrate (Thermo Fisher Scientific, Cat. No. 34075) according to the manufacturer’s instructions.

RNAseq and gene expression profiling RNAseq libraries were prepared with RNA extracted from four Tet2−/− Rhoa G17V primary tumors using the SMARTer Universal Low Input RNA Kit—cDNA Synthesis for NGS (Clontech) and sequenced on an Illumina HiSeq instrument. We obtained an average of 45.63 million reads, 36.09 million (79.10%) of which mapped to the mm10 mouse reference genome using the STAR alignment algorithm (version 2.4.2a) (Dobin et al., 2013) with option –outFilterIntronMotifs RemoveNoncanonical. Relative transcript abundance (expression level) was estimated using cuffquant (cufflinks version 2.0.2) with genecode mouse transcript reference annotation version vM8, followed by cuffnorm for sample normalization. Gene Set Enrichment Analysis (GSEA) (Subramanian et al., 2005) was used to test for the enrichment of Tfh genes (Chtanova et al., 2004) and of an AITL associated signature (de Leval et al., 2007).

For RNAseq analysis of CD4+ cells, RNA was reverse transcribed and prepared for high throughput sequencing using the Illumina TruSeq RNA standard protocol with poly-A enrichment. Libraries were multiplexed and sequenced using Illumina HiSeq2500 at Sulzberger Genome Center, Columbia University. Base calling was performed using RTA (Illumina) and converted to fastq format using bcl2fastq (version 2.17). Reads were aligned to GRCm38 using HiSat2 and transcript-FPKM was computed using Stringtie. Gene level expression profiling and normalization was performed using the Ballgown package in R. Gene Set Enrichment Analysis (GSEA) was performed using javaGSEA and R. Heat maps were generated using log2 normalized gene-level FPKM in R.

T cell receptor variable beta chain (TCR Vβ) repertoire analysis

TCR Vβ repertoire analysis of DNA samples by high throughput sequencing was performed at Adaptive Biotechnologies, (Seattle, USA) using the mouse immunoSEQ assay (Hsu et al., 2016). Data obtained by high throughput sequencing was analyzed with Adaptive Biotechnologies immunoSEQ analyzer proprietary software. Alternatively, the TCR Vβ repertoire of the Tfh population was analyzed by flow cytometry using a panel of 15 monoclonal antibodies directed against the variable (V) region of the TCRβ chain from the Mouse V β TCR Screening Panel (BD Pharmigen) as previously described (Salameire et al., 2012). Clonal expansion was assessed by comparing of the TCR Vβ repertoire distribution in Tfh cells versus naive non-Tfh CD4+ T cells from the same sample.

Histopathology and immunohistochemistry

Mouse tissues were dissected and fixed on 10% buffered formalin and paraffin-embedded at the Molecular Pathology Shared Resource of the Herbert Irving Comprehensive Cancer Center (HICCC) at Columbia University Medical Center. Tissue sections were subjected to hematoxylin-eosin staining using standard procedures. Immunostaining for GFP, CD3, CD4, PD1, Ki67 and cleaved caspase-3 was performed at HistoWiz, Inc. (Brooklyn, NY). To perform BCL6, B220, PAX5, CD21 and CD31 immunohistochemistry, tissue sections were de-paraffinized using Histoclear followed by antigen-retrieval in citrate buffer at pH 6.4.

Endogenous peroxidase (HRP) activity was blocked by treating the sections with 3% hydrogen peroxide. Immunohistochemistry was performed with antibodies targeting BCL6, B220, PAX5, CD21 and CD31 followed by species-specific biotinylated secondary antibodies in the presence of by avidin–horseradish peroxidase and DAB color substrate (Vector Laboratories). After immunohistochemistry, tissue sections were counterstained with hematoxylin. Slides were scanned using a Leica SCN 400 scanner and photomicrographs were examined with Aperio ImageScope Software (Leica Biosystems).

Cytokine analysis

We analyzed the repertoire of cytokines present in the supernatants of T cell primary cultures or in mouse blood serum by flow cytometry using the BDTM Cytometric Bead Array (CBA) (BD Biosciences, Cat. No. 560485) according to the manufacturer’s directions. VEGFA was analyzed by enzyme-linked immunosorbent assay (ELISA) using mouse the VEGFA Platinum ELISA kit (eBioscience, Cat. No. BMS6192) as described in the manufacturer’s directions.

Quantification and Statistical Analysis

Statistical analyses were conducted using Microsoft Excel 2013 and Prism software v6.0 (GraphPad Software, La Jolla, CA, USA). Results were reported as mean ± SD (standard deviation) as indicated in the figure legends unless otherwise stated. We performed analyses of significance using Student’s t-test assuming equal variance. Continuous biological variables were assumed to follow a normal distribution. A p value of <0.05 was considered to indicate statistical significance. Survival in mouse experiments was represented as a Kaplan-Meier curve and Log-rank test was used to determine the significance. All the experiments with representative images have been repeated at least twice and representative images were shown. For experiments with animals "n" represents number of animals (as indicated in Figures 1, 5, 8, S2 and S7). For adoptive transfer experiments ×ばつ105 cells were taken from one mouse. For bone marrow transplants, lineage negative progenitors were isolated from age-matched animals (n=8) with the genotypes of interest and pooled prior to retroviral infection.

Gene set enrichment analysis was performed as previously described by (Subramanian et al., 2005) using the javaGSEA desktop software. The statistical significance of enrichment scores was estimated empirically using a null distribution generated by performing gene permutations on the gene expression data.

Data and Software Availability

RNA-Seq sequencing data are deposited in the Gene Expression Omnibus (GEO) public functional genomics data repository under accession code GSE83918 and GSE101340.

Supplementary Material

supplement

Significance.

Identifying specific molecular lesions and associated key oncogenic pathways susceptible to inhibition with specific agents are major research imperatives in cancer. Here we demonstrate that RHOA G17V, a highly prevalent mutation present in 70% of angioimunoblastic T cell lymphoma cases, drives Tfh lineage specification and AITL transformation through an ICOS-PI3K dependent mechanism. Inhibition of ICOS-PI3K signaling in a Tet2−/− Rhoa G17V AITL mouse model leads to reduced tumor cell proliferation and limits tumor progression in vivo. Our findings highlight the mechanistic role of RHOA G17V in AITL transformation and support a role for Tet2−/− RHOA G17V mouse lymphomas to analyze the natural history of AITL and for the development and testing of targeted therapies.

Highlights.

  • RHOA G17V expression in CD4+ T cells induces Tfh lineage specification.

  • RHOA G17V expression in a Tet2−/− null background results in AITL development.

  • Tet2−/− RHOA G17V tumor proliferation is suppressed by ICOS/PI3K inhibition in vivo.

Acknowledgments

We would like to thank Dr. Ross Levine (Memorial Sloan-Kettering Cancer Center, New York, NY) for kindly providing the Tet2f/f mouse line. This work was supported by the National Cancer Institute (R01 CA197945-01 to T.P.) and the Leukemia & Lymphoma Society (TRP-6507-17 to T.P. and TRP- 6163-12 to A.F.). OAB was supported by Institut National du Cancer (INCA), 2013-1-PL BIO-09, INCa-DGOS-INSERM 6043, equipe labellisée Ligue Nationale Contre le Cancer (LNCC), INCa and INCa-DGOS-INSERM 6043. ACdSA was funded by a Leukemia and Lymphoma Society Special Fellowship Award. LC was funded by a postdoctoral grant from ITMO (Institut Multi Organismes Cancer, France) and INCa (Institut National du Cancer, France).

Footnotes

AUTHOR CONTRIBUTIONS

JRC, LC, CSK, ZW, LB, MSM, and ACdSA performed experiments or analyzed data; AAI and SAQ performed bioinformatics analysis; GB provided histopathological analysis of mouse tumors and analyzed data; LS and OAB provided mouse lines; AF directed and supervised research; TP designed the study, directed and supervised research and wrote the manuscript.

DECLARATION OF INTERESTS

The authors declare no competing interests.

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

  1. Aghajani K, Keerthivasan S, Yu Y, Gounari F. Generation of CD4CreER(T(2)) transgenic mice to study development of peripheral CD4-T cells. Genesis. 2012;50:908–913. doi: 10.1002/dvg.22052. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Aicher A, Hayden-Ledbetter M, Brady WA, Pezzutto A, Richter G, Magaletti D, Buckwalter S, Ledbetter JA, Clark EA. Characterization of human inducible costimulator ligand expression and function. J Immunol. 2000;164:4689–4696. doi: 10.4049/jimmunol.164.9.4689. [DOI] [PubMed] [Google Scholar]
  3. Borroto A, Gil D, Delgado P, Vicente-Manzanares M, Alcover A, Sanchez-Madrid F, Alarcon B. Rho regulates T cell receptor ITAM-induced lymphocyte spreading in an integrin-independent manner. Eur J Immunol. 2000;30:3403–3410. doi: 10.1002/1521-4141(2000012)30:12<3403::AID-IMMU3403>3.0.CO;2-H. [DOI] [PubMed] [Google Scholar]
  4. Boulter E, Estrach S, Garcia-Mata R, Feral CC. Off the beaten paths: alternative and crosstalk regulation of Rho GTPases. FASEB J. 2012;26:469–479. doi: 10.1096/fj.11-192252. [DOI] [PubMed] [Google Scholar]
  5. Burmeister Y, Lischke T, Dahler AC, Mages HW, Lam KP, Coyle AJ, Kroczek RA, Hutloff A. ICOS controls the pool size of effector-memory and regulatory T cells. J Immunol. 2008;180:774–782. doi: 10.4049/jimmunol.180.2.774. [DOI] [PubMed] [Google Scholar]
  6. Chang JH, Pratt JC, Sawasdikosol S, Kapeller R, Burakoff SJ. The small GTP-binding protein Rho potentiates AP-1 transcription in T cells. Mol Cell Biol. 1998;18:4986–4993. doi: 10.1128/mcb.18.9.4986. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Choi YS, Kageyama R, Eto D, Escobar TC, Johnston RJ, Monticelli L, Lao C, Crotty S. ICOS receptor instructs T follicular helper cell versus effector cell differentiation via induction of the transcriptional repressor BCL6. Immunity. 2011;34:932–946. doi: 10.1016/j.immuni.2011年03月02日3. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Chtanova T, Tangye SG, Newton R, Frank N, Hodge MR, Rolph MS, Mackay CR. T follicular helper cells express a distinctive transcriptional profile, reflecting their role as non-Th1/Th2 effector cells that provide help for B cells. J Immunol. 2004;173:68–78. doi: 10.4049/jimmunol.173.1.68. [DOI] [PubMed] [Google Scholar]
  9. Couronne L, Bastard C, Bernard OA. TET2 and DNMT3A mutations in human T cell lymphoma. N Engl J Med. 2012;366:95–96. doi: 10.1056/NEJMc1111708. [DOI] [PubMed] [Google Scholar]
  10. Crotty S. T follicular helper cell differentiation, function, and roles in disease. Immunity. 2014;41:529–542. doi: 10.1016/j.immuni.201410004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. de Leval L, Rickman DS, Thielen C, Reynies A, Huang YL, Delsol G, Lamant L, Leroy K, Briere J, Molina T, et al. The gene expression profile of nodal peripheral T cell lymphoma demonstrates a molecular link between angioimmunoblastic T cell lymphoma (AITL) and follicular helper T (TFH) cells. Blood. 2007;109:4952–4963. doi: 10.1182/blood-2006年10月05日5145. [DOI] [PubMed] [Google Scholar]
  12. del Pozo MA, Vicente-Manzanares M, Tejedor R, Serrador JM, Sanchez-Madrid F. Rho GTPases control migration and polarization of adhesion molecules and cytoskeletal ERM components in T lymphocytes. Eur J Immunol. 1999;29:3609–3620. doi: 10.1002/(SICI)1521-4141(199911)29:11<3609::AID-IMMU3609>3.0.CO;2-S. [DOI] [PubMed] [Google Scholar]
  13. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, Batut P, Chaisson M, Gingeras TR. STAR: ultrafast universal RNA-seq aligner. Bioinformatics. 2013;29:15–21. doi: 10.1093/bioinformatics/bts635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Dupuis J, Boye K, Martin N, Copie-Bergman C, Plonquet A, Fabiani B, Baglin AC, Haioun C, Delfau-Larue MH, Gaulard P. Expression of CXCL13 by neoplastic cells in angioimmunoblastic T cell lymphoma (AITL): a new diagnostic marker providing evidence that AITL derives from follicular helper T cells. Am J Surg Pathol. 2006;30:490–494. doi: 10.1097/00000478-200604000-00009. [DOI] [PubMed] [Google Scholar]
  15. Federico M, Rudiger T, Bellei M, Nathwani BN, Luminari S, Coiffier B, Harris NL, Jaffe ES, Pileri SA, Savage KJ, et al. Clinicopathologic characteristics of angioimmunoblastic T cell lymphoma: analysis of the international peripheral T cell lymphoma project. J Clin Oncol. 2013;31:240–246. doi: 10.1200/JCO.2011373647. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Finer MH, Dull TJ, Qin L, Farson D, Roberts MR. kat: a high-efficiency retroviral transduction system for primary human T lymphocytes. Blood. 1994;83:43–50. [PubMed] [Google Scholar]
  17. Gigoux M, Shang J, Pak Y, Xu M, Choe J, Mak TW, Suh WK. Inducible costimulator promotes helper T cell differentiation through phosphoinositide 3-kinase. Proc Natl Acad Sci U S A. 2009;106:20371–20376. doi: 10.1073/pnas.0911573106. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Goenka R, Barnett LG, Silver JS, O’Neill PJ, Hunter CA, Cancro MP, Laufer TM. Cutting edge: dendritic cell-restricted antigen presentation initiates the follicular helper T cell program but cannot complete ultimate effector differentiation. J Immunol. 2011;187:1091–1095. doi: 10.4049/jimmunol.1100853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Grogg KL, Attygalle AD, Macon WR, Remstein ED, Kurtin PJ, Dogan A. Expression of CXCL13, a chemokine highly upregulated in germinal center T-helper cells, distinguishes angioimmunoblastic T cell lymphoma from peripheral T cell lymphoma, unspecified. Mod Pathol. 2006;19:1101–1107. doi: 10.1038/modpathol.3800625. [DOI] [PubMed] [Google Scholar]
  20. Hatzi K, Nance JP, Kroenke MA, Bothwell M, Haddad EK, Melnick A, Crotty S. BCL6 orchestrates Tfh cell differentiation via multiple distinct mechanisms. J Exp Med. 2015;212:539–553. doi: 10.1084/jem.20141380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Heissmeyer V, Vogel KU. Molecular control of Tfh-cell differentiation by Roquin family proteins. Immunol Rev. 2013;253:273–289. doi: 10.1111/imr.12056. [DOI] [PubMed] [Google Scholar]
  22. Hsu MS, Sedighim S, Wang T, Antonios JP, Everson RG, Tucker AM, Du L, Emerson R, Yusko E, Sanders C, et al. TCR Sequencing Can Identify and Track Glioma-Infiltrating T cells after DC Vaccination. Cancer Immunol Res. 2016;4:412–418. doi: 10.1158/2326-6066.CIR-15-0240. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Iqbal J, Wilcox R, Naushad H, Rohr J, Heavican TB, Wang C, Bouska A, Fu K, Chan WC, Vose JM. Genomic signatures in T cell lymphoma: How can these improve precision in diagnosis and inform prognosis? Blood Rev. 2015 doi: 10.1016/j.blre.201508003. [DOI] [PubMed] [Google Scholar]
  24. Jaffe AB, Hall A. Rho GTPases: biochemistry and biology. Annu Rev Cell Dev Biol. 2005;21:247–269. doi: 10.1146/annurev.cellbio.21.020604.150721. [DOI] [PubMed] [Google Scholar]
  25. Jiang Y, Ortega-Molina A, Geng H, Ying HY, Hatzi K, Parsa S, McNally D, Wang L, Doane AS, Agirre X, et al. CREBBP Inactivation Promotes the Development of HDAC3-Dependent Lymphomas. Cancer Discov. 2017;7:38–53. doi: 10.1158/2159-8290.CD-16-0975. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. Johnston RJ, Poholek AC, DiToro D, Yusuf I, Eto D, Barnett B, Dent AL, Craft J, Crotty S. BCL6 and Blimp-1 are reciprocal and antagonistic regulators of T follicular helper cell differentiation. Science. 2009;325:1006–1010. doi: 10.1126/science.1175870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Ko M, Bandukwala HS, An J, Lamperti ED, Thompson EC, Hastie R, Tsangaratou A, Rajewsky K, Koralov SB, Rao A. Ten-Eleven-Translocation 2 (TET2) negatively regulates homeostasis and differentiation of hematopoietic stem cells in mice. Proc Natl Acad Sci U S A. 2011;108:14566–14571. doi: 10.1073/pnas.1112317108. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Leconte J, Bagherzadeh Yazdchi S, Panneton V, Suh WK. Inducible costimulator (ICOS) potentiates TCR-induced calcium flux by augmenting PLCgamma1 activation and actin remodeling. Mol Immunol. 2016;79:38–46. doi: 10.1016/j.molimm.2016年09月02日2. [DOI] [PubMed] [Google Scholar]
  29. Li Z, Cai X, Cai CL, Wang J, Zhang W, Petersen BE, Yang FC, Xu M. Deletion of Tet2 in mice leads to dysregulated hematopoietic stem cells and subsequent development of myeloid malignancies. Blood. 2011;118:4509–4518. doi: 10.1182/blood-2010-12-325241. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Lu KT, Kanno Y, Cannons JL, Handon R, Bible P, Elkahloun AG, Anderson SM, Wei L, Sun H, O’Shea JJ, Schwartzberg PL. Functional and epigenetic studies reveal multistep differentiation and plasticity of in vitro-generated and in vivo-derived follicular T helper cells. Immunity. 2011;35:622–632. doi: 10.1016/j.immuni.2011年07月01日5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Mayr C, Bartel DP. Widespread shortening of 3′UTRs by alternative cleavage and polyadenylation activates oncogenes in cancer cells. Cell. 2009;138:673–84. doi: 10.1016/j.cell.2009年06月01日6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  32. Moran-Crusio K, Reavie L, Shih A, Abdel-Wahab O, Ndiaye-Lobry D, Lobry C, Figueroa ME, Vasanthakumar A, Patel J, Zhao X, et al. Tet2 loss leads to increased hematopoietic stem cell self-renewal and myeloid transformation. Cancer Cell. 2011;20:11–24. doi: 10.1016/j.ccr.201106001. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mourad N, Mounier N, Briere J, Raffoux E, Delmer A, Feller A, Meijer CJ, Emile JF, Bouabdallah R, Bosly A, et al. Clinical, biologic, and pathologic features in 157 patients with angioimmunoblastic T cell lymphoma treated within the Groupe d’Etude des Lymphomes de l’Adulte (GELA) trials. Blood. 2008;111:4463–4470. doi: 10.1182/blood-2007年08月10日5759. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Muto H, Sakata-Yanagimoto M, Nagae G, Shiozawa Y, Miyake Y, Yoshida K, Enami T, Kamada Y, Kato T, Uchida K, et al. Reduced TET2 function leads to T cell lymphoma with follicular helper T cell-like features in mice. Blood Cancer J. 2014;4:e264. doi: 10.1038/bcj.2014.83. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Palomero T, Couronne L, Khiabanian H, Kim MY, Ambesi-Impiombato A, Perez-Garcia A, Carpenter Z, Abate F, Allegretta M, Haydu JE, et al. Recurrent mutations in epigenetic regulators, RHOA and FYN kinase in peripheral T cell lymphomas. Nat Genet. 2014;46:166–170. doi: 10.1038/ng.2873. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Piccaluga PP, Agostinelli C, Califano A, Carbone A, Fantoni L, Ferrari S, Gazzola A, Gloghini A, Righi S, Rossi M, et al. Gene expression analysis of angioimmunoblastic lymphoma indicates derivation from T follicular helper cells and vascular endothelial growth factor deregulation. Cancer Res. 2007;67:10703–10710. doi: 10.1158/0008-5472.CAN-07-1708. [DOI] [PubMed] [Google Scholar]
  37. Quivoron C, Couronne L, Della Valle V, Lopez CK, Plo I, Wagner-Ballon O, Do Cruzeiro M, Delhommeau F, Arnulf B, Stern MH, et al. TET2 inactivation results in pleiotropic hematopoietic abnormalities in mouse and is a recurrent event during human lymphomagenesis. Cancer Cell. 2011;20:25–38. doi: 10.1016/j.ccr.201106003. [DOI] [PubMed] [Google Scholar]
  38. Sakata-Yanagimoto M, Enami T, Yoshida K, Shiraishi Y, Ishii R, Miyake Y, Muto H, Tsuyama N, Sato-Otsubo A, Okuno Y, et al. Somatic RHOA mutation in angioimmunoblastic T cell lymphoma. Nat Genet. 2014;46:171–175. doi: 10.1038/ng.2872. [DOI] [PubMed] [Google Scholar]
  39. Salameire D, Solly F, Fabre B, Lefebvre C, Chauvet M, Gressin R, Corront B, Ciapa A, Pernollet M, Plumas J, et al. Accurate detection of the tumor clone in peripheral T cell lymphoma biopsies by flow cytometric analysis of TCR-Vbeta repertoire. Mod Pathol. 2012;25:1246–1257. doi: 10.1038/modpathol.2012.74. [DOI] [PubMed] [Google Scholar]
  40. Scourzic L, Couronne L, Pedersen MT, Della Valle V, Diop M, Mylonas E, Calvo J, Mouly E, Lopez CK, Martin N, et al. DNMT3A(R882H) mutant and Tet2 inactivation cooperate in the deregulation of DNA methylation control to induce lymphoid malignancies in mice. Leukemia. 2016;30:1388–1398. doi: 10.1038/leu.2016.29. [DOI] [PMC free article] [PubMed] [Google Scholar]
  41. Stone EL, Pepper M, Katayama CD, Kerdiles YM, Lai CY, Emslie E, Lin YC, Yang E, Goldrath AW, Li MO, et al. ICOS coreceptor signaling inactivates the transcription factor FOXO1 to promote Tfh cell differentiation. Immunity. 2015;42:239–251. doi: 10.1016/j.immuni.2015年01月01日7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Subauste MC, Von Herrath M, Benard V, Chamberlain CE, Chuang TH, Chu K, Bokoch GM, Hahn KM. Rho family proteins modulate rapid apoptosis induced by cytotoxic T lymphocytes and Fas. J Biol Chem. 2000;275:9725–33. doi: 10.1074/jbc.275.13.9725. [DOI] [PubMed] [Google Scholar]
  43. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP. Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A. 2005;102:15545–15550. doi: 10.1073/pnas.0506580102. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Wang C, McKeithan TW, Gong Q, Zhang W, Bouska A, Rosenwald A, Gascoyne RD, Wu X, Wang J, Muhammad Z, et al. IDH2R172 mutations define a unique subgroup of patients with angioimmunoblastic T cell lymphoma. Blood. 2015;126:1741–1752. doi: 10.1182/blood-2015-05-644591. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Warner K, Weit N, Crispatzu G, Admirand J, Jones D, Herling M. T cell receptor signaling in peripheral T cell lymphoma - a review of patterns of alterations in a central growth regulatory pathway. Curr Hematol Malig Rep. 2013;8:163–172. doi: 10.1007/s11899-013-0165-2. [DOI] [PubMed] [Google Scholar]
  46. Weber JP, Fuhrmann F, Feist RK, Lahmann A, Al Baz MS, Gentz LJ, Vu Van D, Mages HW, Haftmann C, Riedel R, et al. ICOS maintains the T follicular helper cell phenotype by down-regulating Kruppel-like factor 2. J Exp Med. 2015;212:217–233. doi: 10.1084/jem.20141432. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Xie M, Lu C, Wang J, McLellan MD, Johnson KJ, Wendl MC, McMichael JF, Schmidt HK, Yellapantula V, Miller CA, et al. Age-related mutations associated with clonal hematopoietic expansion and malignancies. Nat Med. 2014;20:1472–1478. doi: 10.1038/nm.3733. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Yang JQ, Kalim KW, Li Y, Zhang S, Hinge A, Filippi MD, Zheng Y, Guo F. RhoA orchestrates glycolysis for TH2 cell differentiation and allergic airway inflammation. J Allergy Clin Immunol. 2016;137:231–245. e234. doi: 10.1016/j.jaci.201505004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Yoo HY, Sung MK, Lee SH, Kim S, Lee H, Park S, Kim SC, Lee B, Rho K, Lee JE, et al. A recurrent inactivating mutation in RHOA GTPase in angioimmunoblastic T cell lymphoma. Nat Genet. 2014;46:371–375. doi: 10.1038/ng.2916. [DOI] [PubMed] [Google Scholar]
  50. Yu D, Batten M, Mackay CR, King C. Lineage specification and heterogeneity of T follicular helper cells. Curr Opin Immunol. 2009;21:619–625. doi: 10.1016/j.coi.2009年09月01日3. [DOI] [PubMed] [Google Scholar]
  51. Yu D, Tan AH, Hu X, Athanasopoulos V, Simpson N, Silva DG, Hutloff A, Giles KM, Leedman PJ, Lam KP, et al. Roquin represses autoimmunity by limiting inducible T cell co-stimulator messenger RNA. Nature. 2007;450:299–303. doi: 10.1038/nature06253. [DOI] [PubMed] [Google Scholar]
  52. Zhang S, Konstantinidis DG, Yang JQ, Mizukawa B, Kalim K, Lang RA, Kalfa TA, Zheng Y, Guo F. Gene targeting RhoA reveals its essential role in coordinating mitochondrial function and thymocyte development. J Immunol. 2014;193:5973–5982. doi: 10.4049/jimmunol.1400839. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

supplement

ACTIONS

RESOURCES

AltStyle によって変換されたページ (->オリジナル) /