Write a program that: Gets a character array (C-string) using cin.g

Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or recursively, but I believe most people will find the iterative version much easier. C++: We consider the empty string to have balanced parentheses, as there is no imbalance. Your program should accept as input a single string containing only the characters ) and (, and output a single line stating true or false. The functionality for reading and printing answers is written in the file parentheses.checker.cpp; your task is to complete the has balanced.parentheses () function. **Hint: There's a pattern for how to determine if parentheses are balanced. Try to see if you can find that pattern first before coding this method up.

String Manipulation In this question, you will be implementing the following functions int findChar(char * str, char c); Searches for the character c in the string str and returns the index of the character in the string. If the character does not exist, returns -1 int replaceChar(char * str, char c1, char c2); Searches for the character c1 in the string str and if found, replace it with c2.The function returns the number of replacements it has performed. If the character does not exist, returns 0. int removeChar(char * str1, char * str2, char c); Creates a copy of str1 into str2 except for the character c that should be replaced with ‘*’ For example, if str1="Hello World" and c=’l’ then the function should make str2="He**o Wor*d" int isPalindrome(char * str) Checks to see if a string is Palindrome(reversible). If it is, returns 1, otherwise returns 0. A palindrome string reads similarly from left to right and from right to left like madam, level, radar, etc. int reverseString(char...

C++ Use 2 D arrays String and float Make simple

C++ format please, thanks Write a function named "FriendsWithPets" that takes a const reference to a std::map of my friends names (std::string) to the number of pets they own (int) and returns the number of friends (int) that have at least one pet. You should be using the STL algorithms to achieve this and no looping (no "while" or "for" keywords anywhere in the solution). #include<map> #include<algorithm> #include<iostream> #include<regex>

C++

A C-string variable is an array, so we can use index operator [ ] to access individual character. True or false?

Topic: Array covered in Chapter 7 Do not use any topic not covered in lecture. Write a C++ program to store and process an integer array. The program creates an array (numbers) of integers that can store up to 10 numbers. The program then asks the user to enter up to a maximum of 10 numbers, or enter 999 if there are less than 10 numbers. The program should store the numbers in the array. Then the program goes through the array to display all even (divisible by 2) numbers in the array that are entered by the user. Then the program goes through the array to display all odd (not divisible by 2) numbers in the array that are entered by the user. At the end, the program displays the total sum of all numbers that are entered by the user.

Using C++ Language Write a program to implement the following: • Declare two C-strings str1 and str2 of appropriate sizes. • Use strcpy() to copy the string "Hello World." into str1 • Using a suitable message, read the user input into str2. The user may enter more than one word. • Determine and store the length of both char arrays using strlen() • Check if both char arrays are the same length using the stored lengths o If they are the same length, tell the user they are the same length o If they are not the same length, tell the user the strings are different and end the program using a return statement. • Compare both strings using strcmp to check if they are the same string. o If they are the same string, inform the user of this o If they are not the same string, inform the user of this o Note that you compare only if they are of the same length, hence the return statement in the earlier step.

Match the std::string constructor on right to its function on left. Source: https://cplusplus.com/reference/string/string/string/ E string() string (const string& str) string (const char* s) string (size_t n, char c) [Choose] [Choose ] constructs a copy of str. constructs an empty string, with a length of zero characters. copies the null-terminated character sequence (C-string) pointed by s. fills the string with n consecutive copies of character c. [Choose ]

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

C++ Coding: Arrays Implement a two-dimensional character array. Use a nested loop to store a 12x6 flag. 5 x 2 stars as * Alternate = and – to represent stripe colors Use a nested loop to output the character array to the console.

See attached images C++