Write a function in Python that takes two strings of DNA sequence (say string1 and string2) as input and returns a list of the position(s) where string2 is present as a substring of string1. If there are no positions an empty list should be returned. When printing positions use 1 as the first position, rather than the 0 used by Python. The output using the above string/substring should be [3, 7]. Print the output of your function to search for the three words below. # Insert your code for Question 1 below seq = 'CGTATACTAAAACGGACGTTACGATATTGTCTCACTTCATCTTACCACCCTCTATCTTATTGCTGATAGAACACTAACCCCTCAGCTTTATTTCTA' def linear(seq, sub): positions = () return( positions ) print( linear( seq,'ATG') ) print( linear( seq,'CAT') ) print( linear( seq,'TAGG') )

1) Below is Program that take two string of DNA sequence and return the list of positions of string2 present in string1

• It defines a function linear take two string, returns the list of position of second string in first string
  • It creates a list to store positions
  • Runs a loop to iterate through each character in the seq
    • Check if a sub string present in seq string
      • Append the index of substring
      • Increment index by 1 so it prints position from 1 instead of 0
  • return position list
• It calls the function linear with seq and sub string and display list

2) Save program in python file and run

Step by stepSolved in 3 steps with 1 images