What are the memory sections for variables in the following code: int *x=new int; static int y; int z;

Question 6 Arrays in c++ can contain different data types (a single array with different data types). O True O False

{JAVA programing} Declare and initialize an integer variable named num with the value 10.Declare and initialize a double variable named pi with the value 3.14159.Declare and initialize a boolean variable named isTrue with the value true.Declare and initialize a string array variable named colors with the values "red", "green", and "blue".Print the value of num, pi, and isTrue to the console.Use a for loop to iterate over the colors array and print each color to the console.

Given the following code, what is the value of *p? int i;int *p;i = 5;p = &i;

C PROGRAMMING HELP I need help with an old script of mine. I'm having trouble getting math involving accessing an array to work properly, I'm getting an error message that's puzzling me. I'm pretty sure the solution is simple and right in front of me but it's stumping me. Below is the script: #include <stdio.h>#include <math.h>void value(float x){ printf("what is the value of x?"); scanf("%f",&x); }void power(float i,int p,int x,float arr[100]){ float equation,butt; printf("what is the highest power in the series?"); scanf("%d",&p); for (i = 0; i < p; ++i) equation = pow(x,i); //how the hell do i get the counter to do what i want butt = 1+equation^arr[i];}void shortcut(int x){ shortcut = 1/(1-x)}int main(){ printf("Here is the result!:") printf("%d %f", p, f); printf("If we had used shortcut, value would be: %d", shortcut); int diff; diff = shortcut - butt; printf("The difference is only %0.2f!",diff);...

Look at the following C++ code and comment each line about how it works with pointer. int i = 33; double d = 12.88; int * iPtr = &i; double * dPtr = &d; // iPtr = &d; // dPtr = &i; // iPtr = i; // int j = 99; iPtr = &j; //

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

C++ printSmaller is a function that accepts two int parameters and returns no value. It will print the value of the smaller one parameters. The function protoype is as follows: void printSmaller(int num1, int num2); write the statments to read two integers and call this function to display the smaller one.

C++ Array Expander -Just do everything in main and make sure you comment each step Use Pointer Notation for the function and within the function. Use a main function and return the pointer from the ArrayExpander function to main

Programming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];...

Write three void functions: Input three numbers, sort the three numbers, display the three numbers. Write a main program to test the functions. void input (int &a, int &b, int &c); void sort3 (int &a, int &b, int &c); void display (int a, int b, int c);