upposed to count how many times a certain base (represented as a character variable in Python) appears in a dna sequence (represented as a string variable in Python): def count1(dna, base): i = 0 for c in dna: if c == base: i += 1 return i def count2(dna, base): i = 0 for j in range(len(dna)): if dna[j] == base: i += 1 return i

Write a function in Swift programming language that takes an integer array as parameters and returns a boolean value to determine whether an integer is present sequentially three times in the array or not.

Complete the code that returns the value of f(x), which has the value 1 inside the range -1 < x < 1 otherwise it is the value 0. хе[-1,1] 1, S(x) = { 0, otherwise 277]: # complete the function to return the value of f(x) given x. # return as the value called variable "fval" def function_f(x): # your code here return fval

Data Structures the hasBalancedParentheses () method. Note: this can be done both iteratively or recursively, but I believe most people will find the iterative version much easier. C++: We consider the empty string to have balanced parentheses, as there is no imbalance. Your program should accept as input a single string containing only the characters ) and (, and output a single line stating true or false. The functionality for reading and printing answers is written in the file parentheses.checker.cpp; your task is to complete the has balanced.parentheses () function. **Hint: There's a pattern for how to determine if parentheses are balanced. Try to see if you can find that pattern first before coding this method up.

The following functions are all supposed to count how many times a certain base (represented as a character variable in Python) appears in a dna sequence (represented as a string variable in Python): def count1(dna, base): i = 0 for c in dna: if c == base: i += 1 return i def count2(dna, base): i = 0 for j in range(len(dna)): if dna[j] == base: i += 1 return i def count3(dna, base): match = [c == base for c in dna] return sum(match) def count4(dna, base): return dna.count(base) def count5(dna, base): return len([i for i in range(len(dna)) if dna[i] == base]) def count6(dna,base): return sum(c == base for c in dna) ======================================================================================= Which of them is correct? count 3, and count 6 only count 1, count 3, and count 4 only All of them are correct. count 1, count 3, count 4, and count 6 only

Asap

Given the following pseudocode: function fun(n) { var outer_count=0; var inner_count=0; var sum = 0; for (var i=0; i 0, as an expression of normal arithmetic and n, what is the value of outer_count that counts the number of times the outer loop executes? Enter an expression Fun.1.inner: Assuming n EN and n> 0, as an expression of normal arithmetic and n, what is the value of inner_count that counts the number of times the inner loop executes? Enter an expression

In C++, write a program that generates a random number for (x) to calculate A with the given formula: A = (2/5 * ((x ^ 2) - 6))

In C++, Given the following mystery function, what is the output if the number passed to the function is 7: int mystery(int number) { if (number == 0 || number == 1) return number; else return mystery(number - 1) + mystery(number - 2); }

PYTHON Problem Statement Given a list of numbers (nums), for each element in nums, calculate how many numbers in the list are smaller than it. Write a function that does the calculation and returns the result (as a list). For example, if you are given [6,5,4,8], your function should return [2, 1, 0, 3] because there are two numbers less than 6, one number less than 5, zero numbers less than 4, and three numbers less than 8. Sample Input smaller_than_current([6,5,4,8]) Sample Output [2, 1, 0, 3]

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

Problem taken from LeetCode // Problem Statement : // You are given a string. // Write a function that takes a string as input and reverse only the vowels of a string. // Example : // Sample Input - 1 : // "hello" // Sample Output - 1 : // "holle" // Sample Input - 2 : // "leetcode" // Sample Output - 2 : // "leotcede" class Solution {public: string reverseVowels(string s) { int i = 0 , j = s.size() - 1; while(i < j) { while(i < j && (s[i] != 'a' && s[i] != 'e' && s[i] != 'i' && s[i] != 'o' && s[i] != 'u' && s[i] != 'A' && s[i] != 'E' && s[i] != 'I' && s[i] != 'O' && s[i] != 'U' )) { i++;...