Under what circumstances should you use a for loop rather than a foreach loop to process data stored in an array?

Sorted Names Problem Assume that you already have the bubbleSort () and the svap() modules. Use pseudocode to design the main() program that allows the user to enter 20 names into a String array. Sort the array in ascending (alphabetical) order and display its contents. // The bubbleSort module accepts an array of Strings and array size // and sorts array in ascending order Module bubbleSort(String Ref array[], integer arraySize) Declare Integer index1, index2 // bubblesort scores For index1 = arraySize – 1 to 0 Step -1 For index2 = 0 to index1 – 1 If array[index2] > array[index2 + 1] Then Call swapS(array[index2], array[index2 + 1) End If End For End For End Module // The swapS module accepts two String elements and swaps their contents Module swapS(String ref a, String ref b) Declare String temp // Swap a and b Set temp = a Set a = b Set b = temp End Module

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

C++ Coding: Arrays Implement a two-dimensional character array. Use a nested loop to store a 12x6 flag. 5 x 2 stars as * Alternate = and – to represent stripe colors Use a nested loop to output the character array to the console.

When is it necessary to build an array?