Multidimensional Array Enhanced For-loop Input Scanner method using Case-statements Simple AI as machine input 1. Declare a multidimensional array of char to draw a table -+-+- -+-+ 2. Use the enhanced for-loop to display the table for (char[] row:charName) { for (char c:row) System.out.print(c); System.out.println (); 3. Initialize some value (inside the table) in the array charName [0] [0] = '1'; 4. Using Scanner for user input and case statement to put some character inside the table Scanner scan = new Scanner (System.in); int pos = scan.nextInt (); 5. Create some method/function to be used to add functionality to the application program. 6. Add simple AI (for machine input) 7. Using Arraylist to scan patterns in the multidimensional array.

C++

In visual basic Print out the last value in a single-dimensional array.

// MichiganCities.cpp - This program prints a message for invalid cities in Michigan. // Input: Interactive // Output: Error message or nothing #include <iostream> #include <string> using namespace std; int main() { // Declare variables string inCity; // name of city to look up in array const int NUM_CITIES = 10; // Initialized array of cities string citiesInMichigan[] = {"Acme", "Albion", "Detroit", "Watervliet", "Coloma", "Saginaw", "Richland", "Glenn", "Midland", "Brooklyn"}; bool foundIt = false; // Flag variable int x; // Loop control variable // Get user input cout << "Enter name of city: "; cin >> inCity; // Write your loop here // Write your test statement here to see if there is // a match. Set the flag to true if city is found. // Test to see if city was not found to determine if // "Not a city in Michigan" message should be printed....

DebugEight4: Here is the code that needs to be debugged, I fixed some but it will not display the words in reverse at the end: // Application allows user to enter a series of words // and displays them in reverse order import java.util.*; public class DebugEight4 { public static void main(String[] args) { Scanner input = new Scanner(System.in); int x = 0, y; String array[] = new String[100]; String entry; final String STOP = "XXX"; StringBuffer message = new StringBuffer("The words in reverse order are\n"); System.out.println("Enter any word\n" + "Enter + STOP + when you want to stop"); entry = input.next(); while(!(entry.equals(STOP))) { array[x] = entry; ++x; System.out.println("Enter another word\n" + "Enter " + STOP + " when you want to stop"); entry = input.next(); } for(y = x - 1; y > 0; ++y) {...

C PROGRAMMING LANGUAGE

C programming

Can you fix the code please on the first picture shows the error output. // Corrected code #define _CRT_SECURE_NO_WARNINGS #include "LibraryManagement.h" #include "Books.h" #include "DigitalMedia.h" #include "LibraryConfig.h" #include #include #include #include // Include the necessary header for boolean data type // Comparison function for qsort to sort Digital Media by ID int compareDigitalMedia(const void* a, const void* b) { return ((struct DigitalMedia*)a)->id - ((struct DigitalMedia*)b)->id; } // initializing library struct Library initializeLibrary() { struct Library lib; lib.bookCount = 0; lib.ebookCount = 0; lib.digitalMediaCount = 0; // Initialize book array for (int i = 0; i < MAX_BOOK_COUNT; i++) { lib.books[i].commonAttributes.id = -1; // Set an invalid ID to mark empty slot } // Initialize ebook array for (int i = 0; i < MAX_EBOOK_COUNT; i++) { lib.ebooks[i].commonAttributes.id = -1; }...

//Assignment 06 */public static void main[](String[] args) { String pass= "ICS 111"; System.out.printIn(valPassword(pass));} /* public static boolean valPassword(String password){ if(password.length() > 6) { if(checkPass(password) { return true; } else { return false; } }else System.out.print("Too small"); return false;} public static boolean checkPass (String password){ boolean hasNum=false; boolean hasCap = false; boolean hasLow = false; char c; for(int i = 0; i < password.length(); i++) { c = password.charAt(1); if(Character.isDigit(c)); { hasNum = true; } else if(Character.isUpperCase(c)) { hasCap = true; } else if(Character.isLowerCase(c)) { hasLow = true; } } return true; { return false; } }

Fix the errors and send the code please // Application allows user to enter a series of words // and displays them in reverse order import java.util.*; public class DebugEight4 { public static void main(String[] args) { Scanner input = new Scanner(System.in); int x = 0, y; String array[] = new String[100]; String entry; final String STOP = XXX; StringBuffer message = new StringBuffer("The words in reverse order are\n"); System.out.println("Enter any word\n" + "Enter + STOP + when you want to stop"); entry = input.next(); while(!(entry.equals(STOP))) { array[x] = entry; ++x; System.out.println("Enter another word\n" + "Enter " + STOP + " when you want to stop"); entry = input.next(); } for(y = x - 1; y > 0; ++y) { message.append(array[y]); message.append("\n"); } System.out.println(message) }

Code in C Code in the file IO: /************************************************************* This program prints a degree-to-radian table using a for- loop structure. The results are printed to a file and the the screen. *************************************************************/ #include <stdio.h> #define PI 3.141593 #define FILENAME "tableD2R.dat" int main(void) { /* Declare variables. */ double radians; FILE *fileout; /* Open file. */ fileout = fopen(FILENAME,"w"); if (fileout == NULL) printf("Error opening input file. \n"); else { /* Print radians and degrees in a loop. */ printf("Degrees to Radians \n"); for (int degrees=0; degrees<=360; degrees+=10) { radians = degrees*PI/180; printf("%6i %9.6f \n",degrees,radians); fprintf(fileout,"%6i %9.6f \n",degrees,radians); } /* Exit program. */ }

Enhanced selection sort algorithm SelectionSortDemo.java package chapter7; /** This program demonstrates the selectionSort method in the ArrayTools class. */ public class SelectionSortDemo { public static void main(String[] arg) { int[] values = {5, 7, 2, 8, 9, 1}; // Display the unsorted array. System.out.println("The unsorted values are:"); for (int i = 0; i < values.length; i++) System.out.print(values[i] + " "); System.out.println(); // Sort the array. selectionSort(values); // Display the sorted array. System.out.println("The sorted values are:"); for (int i = 0; i < values.length; i++) System.out.print(values[i] + " "); System.out.println(); } /** The selectionSort method performs a selection sort on an int array. The array is sorted in ascending order. @param array The array to sort. */ public static void selectionSort(int[] array) { int startScan, index, minIndex, minValue; for (startScan = 0; startScan < (array.length-1); startScan++) { minIndex = startScan; minValue...

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...