Give a recursive definition for the set X of all binary strings with an even number of 0's. B1. λ is in X B2- 1 is in X R1. If x is in X, so is 0x0. R2. If x and y are in X, so is 0 X

help

An alphabetical list of 128 numeric codes that represent English letters, punctuation marks, and other symbols.

need help with d,e,f, and g

Describe the role of package managers in software development.

Please provide a list of the top six reasons why it's useful to understand how compilers work.

Python code not working, please check my code. Here is the question it is based off: Building and using DNA Motifs Background Sequence motifs are short, recurring (meaning conserved) patterns in DNA that are presumed to have a biological function. Often they indicate sequence-specific binding sites for proteins and other important markers. However, sometimes they are not exactly conserved, meaning some mutations can happen in a motif in a particular organism. Mutations can be DNA substitutions/deletions/insertions. Therefore, sequences are usually aligned and a consensus pattern of a motif is calculated over all examples from organisms. The following are examples of a transcription factor binding (TFB) site for the lexA repressor in_ E. Coli _located in a file called lexA.fasta: >dinD 32->52 aactgtatataaatacagtt >dinG 15->35 tattggctgtttatacagta >dinH 77->97 tcctgttaatccatacagca >dinI 19->39 acctgtataaataaccagta >lexA-1 28->48 tgctgtatatactcacagca...

Please make a list of the types of games can I create using java