following snippet of pseudocode fails to live up to all of the clarity, correctness, and termination requirements of algorithms. In each case, describe the failing step, and then rewrite the pseudocode as a proper algorithm. def long_division(numerator, denominator): quotient = numerator/denominator remainder = numerator % denominator

____ is the simplification of an algorithm’s runtime to its greatest term, giving us a function that describes the functions worst case relative growth.

The triangle.cpp ProgramDoes recursion actually work? If you run the triangle.cpp program, you’ll see that itdoes. The program uses recursion to calculate triangular numbers. Enter a value for the term number, n, and the program will display the value of the corresponding triangular number. show the triangle.cpp program

Algorithm Design and Analysis 1. Body wanted to go on a tour but he was confused about what items to bring. In order to show his wealth, he decided to bring the item with the highest value. But the suitcase only holds 5KG left. Body asks your help to choose from the list below. Name Price Weight (kg) A 460 4 B 220 1.5 C 360 3 D 220 1 E 400 3.5 F 480 2.5 G 150 2 2. Use KMP to complete the following string matching! T= ACGTACGTGACGTGTACGATATCACGTACT P= ACGTACT

Count divisibles in range def count_divisibles_in_range(start, end, n): Let us take a breather by tackling a problem simple enough that its solution needs only a couple of conditional statements and some arithmetic, but not even one loop or anything even more fancy. The difficulty is coming up with the conditions that cover all possible cases of this problem exactly right, including all of the potentially tricksy edge and corner cases, without being off-by-one. Given three integers start, end and n so that start <= end, count how many integers between start and end, inclusive, are divisible by n. Sure, you could solve this problem with the list comprehension one-linerreturn len([x for x in range(start, end+1) if x % n == 0]) but of course the automated tester is designed so that anybody trying to solve this problem in such a blunt fashion will only find themselves running out of both time and space! Your code should have no loops at all, but use only integer arithmetic and...

Write a recursive function to sort an array of integers into ascending order using the following idea: the function must place the smallest element in the first position, then sort the rest of the array by a recursive call. This is a recursive version of the selection sort. (Note: You will probably want to call an auxiliary function that finds the index of the smallest item in the array. Make sure that the sorting function itself is recursive. Any auxiliary function that you use may be either recursive or iterative.) Embed your sort function in a driver program to test it. Turn in the entire program and the output.

Any well-considered algorithm needs to be completely clear.

Write a recursive algorithm with the following prototype: int add (int x, int y); that returns x if y is 0; and adds x to y otherwise. THE FUNCTION MUST BE RECURSIVE. (hint: the base case should involve a test for y being 0; recursive case should reduce y towards 0)

A fractal pattern has the sequence {1, 10, 100, 1000, ...}. The recursive formula is _________.

help in pytyhon