Database System Concepts
Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Bartleby Related Questions Icon
Related questions
Question
C++ :
Write a function that has three C++ strings as parameters. It searches the first parameter to find the second
parameter (as a substring) and replaces it with the third parameter. It returns the changed first parameter if the substring
can be found; otherwise, it returns the original first parameter. Test your function in a program.
Expert Solution
Check MarkThis question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
bartleby
This is a popular solution
bartleby
Trending nowThis is a popular solution!
bartleby
Step by stepSolved in 4 steps with 2 images
Knowledge Booster
Background pattern image
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...arrow_forward5. use c code to Write a stringSearch function that gets two strings one called needle and the other called haystack. It then searches in the Haystack for the needle. If it finds it, it returns the index of where the needle starts in the haystack. If the needle cannot be found, it should return -1 Prototype: int stringSearch(char needle[], char haystack) Example1: Haystack: "This is just an example" Needle: "just" Result: 8 Example2: Haystack: "This is just an example" Needle: "This" Result: 0 Example3: Haystack: "This is just an example" Needle: "this" Result: -1 Hint: all the answer need to include an output and use c code to answerarrow_forwardProgramming technique exercise Question 1). Write a complete C++ program that helps the teacher to calculate the result of students in the test of Programming Technique. The program should perform the following tasks: • Write a function named getinput. This is a non-returning function. It takes the score of question 1, score of question 2, and score of question 3 as input parameters. the function should ask the user to enter the score (per 100) for each question. It sends all the values entered by the user in (c) back to the calling module through the use of reference parameters. • Write a function named dispTier. This is a non-returning function. It takes the total marks as an input parameter. The function should display the tier based on the conditions. Tier 3 = below 40%, tier 2 = below75%, tier 1=75% and above • Write a function named calcAverage. I It takes the number of students and total marks as input parameters.arrow_forward
Recommended textbooks for you
- Text book imageDatabase System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill EducationText book imageStarting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSONText book imageDigital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON
- Text book imageC How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSONText book imageDatabase Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage LearningText book imageProgrammable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Text book image
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Text book image
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Text book image
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
Text book image
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Text book image
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Text book image
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education