C programming:you are to design and write a menu driven program as shown by the sample menu below. should the user select [G] the program will ask the user to enter a single deposit into the bank account(this would be a 1D array) the rest of the menu options are self-explanatory. demonstrate a bubble sort, the usee of user preventive coding, switch statement, demonstrate the use of functions along will call by value and call by reference where necessary. Program Menu System (Your solution should display this menu) **** BANKING MAIN MENU*** [G]et a new deposit [S]um of all deposits [D]eposits will be displayed from highest to lowest deposit [A]verage of all deposits [L]owest deposit will be displayed [Q]uit the program Do not use global variables, goto statements . do not put code in the cases. main() should have do, while and switch and a bunch of function calls

Customized step counter Learning Objectives In this lab, you will Create a function to match the specifications Use floating-point value division Instructions A pedometer treats walking 2,000 steps as walking 1 mile. It assumes that one step is a bit over 18 inches (1 mile = 36630 inches, so the pedometers assume that one step should be 18.315 inches). Let's customize this calculation to account for the size of our stride. Write a program whose input is the number of steps and the length of the step in inches, and whose output is the miles walked. Output each floating-point value with two digits after the decimal point, which can be achieved as follows: print(f'{your_value:.2f}') Ex: If the input is: 5345 18.315 the output is: You walked 5345 steps which are about 2.67 miles. Your program must define and call the following function. The function should return the number of miles walked.def steps_to_miles(user_steps, step_length) # Define your function here if __name__...

In C++Using the code provided belowDo the Following: Modify the Insert Tool Function to ask the user if they want to expand the tool holder to accommodate additional tools Add the code to the insert tool function to increase the capacity of the toolbox (Dynamic Array) USE THE FOLLOWING CODE and MODIFY IT: #define _SECURE_SCL_DEPRECATE 0 #include <iostream> #include <string> #include <cstdlib> using namespace std; class GChar { public: static const int DEFAULT_CAPACITY = 5; //constructor GChar(string name = "john", int capacity = DEFAULT_CAPACITY); //copy constructor GChar(const GChar& source); //Overload Assignment GChar& operator=(const GChar& source); //Destructor ~GChar(); //Insert a New Tool void insert(const std::string& toolName); private: //data members string name; int capacity; int used; string* toolHolder; }; //constructor GChar::GChar(string n, int cap) { name = n; capacity = cap; used = 0; toolHolder = new...

Fill in the Blank Word GameThis exercise involves creating a fill in the blank word game. Try prompting the user to enter a noun,verb, and an adjective. Use the provided responses to fill in the blanks and then display the story.First, write a short story. Remove a noun, verb, and an adjective.Create a function that asks for input from the user.Create another function that will fill the blanks in the story you’ve just created.Ensure that each function contains a docstring.After the noun, verb, and adjective have been collected from the user, display the story that has beencreated using their input. use python to ode.

Create a c programming flowgorithm chart for the following: You must use at least two different arrays A character array to store the welcome message (note: when creating your flowchart you will need to declare this message with the string data type as a variable and assign the message). Use the puts() function to display the message to the screen. An array with a float datatype to store the prices of the items Prompt the user to enter how many items they have to total. Use a for() statement to fill the array using the value the user entered as the end point of the loop. Use an accumulating total statement to compute the total sales There is a constraint - if the price of any one item is greater than 10ドル.00 it is considered invalid, you must use a repetitive statement to display a message and force the user to enter a value less than 10ドル.00 You need to create a function to compute the final total using a sales tax of 6% (.06)

C++ Coding: ArraysTrue and False Code function definitions for eoNum() and output(): Both eoNum() and output() are recursive functions. output() stores the even/odd value in an array. Store 0 if the element in the data array is even and store 1 if the element in the data array is odd. eoNum() displays all the values in an array to the console.

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

# Exercise 8: Create a function that takes the sum of three numbers and returns the value # Make sure to use the function and display the result # When you are done, get 3 numbers from a user and then print out the sum using your function

er 6 Functions Programming Exercises te 1. Rectangle Area ngle Area The area of a rectangle is calculated according to the following formula: Area = Width X Length Design a function that accepts a rectangle's width and length as arguments and returns the rectangle's area. Use the function in a program that prompts the user to enter the rectangle's width and length, and then displays the rectangle's area.

language = python

C Programming Write function checkHorizontal to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square to the left or right is a space, stop checking d. If the square to the left or right is the same character as the player’s character, save that it was a flank, stop checking e. If the square to the left or right is not the same character as the player’s character, count the disc f. If the counted discs is greater than zero AND the player found their own character, return the counted discs, otherwise return ZERO Write function checkVertical to count how many discs of the opposing player would be flipped, it should do the following a. Return type integer b. Parameter list i. int rowii. int col iii. char board[ROW][COL] iv. char playerCharc. If the square above or below is a space, stop checking d. If the square above or below is...

Programming Language: C++ 4. Select the two correct statements about stub functions: Select one or more: a. stubs are used to test the functionality of a program b. stubs must return a value c. stubs are programs that test if a called function returns the correct result d. stubs are simpler than the functions they replace