ASSEMBLY It is preferable to pass Arrays by reference when calling subroutines. True False

Task- Median elements (C Language) Example #4 expected output is 5, but from the program below its coming out to 4. Please help make it come out to 5 as expected Given an array of integer elements, the median is the value that separates the higher half from the lower half of the values. In other words, the median is the central element of a sorted array. Since multiple elements of an input array can be equal to the median, in this task you are asked to compute the number of elements equal to the median in an input array of size N, with N being an odd number. Requirements Name your program project4_median.c. Follow the format of the examples below. The program will read the value of N, then read in the values that compose the array. These values are not necessarily sorted. The program should include the following function. Do not modify the function prototype. int compute_median(int *a, int n); a represents the input array, n is the length of the array. The function returns the...

AHPA #10:The Secure Array(use C programming)• A programmer that you work with, Peter, is a jerk.• He is responsible for an array [theArray] that is a key part of an importantprogram and he maintains a sum of the array values at location [0] in the array.• He won't give you access to this array; however, your boss has told you that youneed to get input from the user and then place it into the array.• Each evening Peter will scan the code and remove any illegal references to hisarray.• Using pointers, access Peter's array without him knowing it and place threevalues that you got from the user (101, 63, 21) at locations 3, 6, and 9.Recalculate the sum value and update it. ( the output should be same as the picture)

How difficult is it to duplicate a collection of shared pointers into another array while using the C++ programming language? Create a list of the several approaches you may use to tackle the issue that has been presented to you. Is it the case that copying a shared pointer also copies the objects that it controls? Explain

A pointer variable is O the same thing as an array subscript dereferences a pointer and allows access to the value of the variable the pointer points to an operator that returns the memory address of a variable a variable that holds an address

C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is...

please code in python Forbidden concepts: arrays/lists (data structures), recursion, custom classes You have been asked to take a small icon that appears on the screen of a smart telephone and scale it up so it looks bigger on a regular computer screen.The icon will be encoded as characters (x and *) in a 3 x 3 grid as follows: (refer image1 ) Write a program that accepts a positive integer scaling factor and outputs the scaled icon. A scaling factor of k means that each character is replaced by a k X k grid consisting only of that character. Input Specification:The input will be an integer such that 0 < k ≤ 10. Output Specification:The output will be 3k lines, which represent each individual line scaled by a factor of k and repeated k times. A line is scaled by a factor of k by replacing each character in the line with k copies of the character. [refer image2]

Identify the correct statement. Group of answer choices An array is passed to a method by passing the array's values A method cannot modify the elements of an array argument An array is converted to another data type and passed to a method An array is passed to a method by passing a reference to the array

C++ Language Please add an execution chart for this code like the example below. I have provided the code and the example execution chart. : JUST NEED EXECUTION CHARTTT. Thanks Sample Execution Chart Template//your header files// constant size of the array// declare an array of BankAccount objects called accountsArray of size =SIZE// comments for other declarations with variable names etc and their functionality// function prototypes// method to fill array from file, details of input and output values and purpose of functionvoid fillArray (ifstream &input,BankAccount accountsArray[]);// method to find the largest account using balance as keyint largest(BankAccount accountsArray[]);// method to find the smallest account using balance as keyint smallest(BankAccount accountsArray[]);// method to display all elements of the accounts arrayvoid printArray(BankAccount accountsArray[]);int main() {// function calls come here:// give the function call and a comment about the purpose,//...

in c++ write a code to return the value of fake coin, the fake coin is The different element of the value in the array ،and need for way solution using 1) brute force approaches 2) divide and conquer 3) decrease and conquer 4) transform and conquer and write the time of each one and what the best time of them. in c++ write a code to return the value of fake coin, the fake coin is The different element of the value in the array and be less value (minimum) , need four way solution using 1) brute force approaches 2)divide and conquer 3)decrease and conquer 4) transform and conquer and write the time of each one and what the best time of them.