Eric Just, Senior Bioinformatics Scientist, dictyBase: http://dictybase.org Center for Genetic Medicine, Northwestern University. This is an edited version of Eric’s presentation.
The core of Chado
my $seq_io = new Bio::SeqIO(
-file => "../data/fake_chromosome.txt",
-format => 'fasta'
);
# Bio::SeqIO will return a Bio::Seq object which
# Modware uses as its representation
my $seq = $seq_io->next_seq();
my $reference_feature = new Modware::Feature(
-type => 'chromosome',
-bioperl => $seq,
-description => "This is a test",
-name => 'Fake',
-source => 'GMOD 2007 Demo'
);
# Inserts chromosome into database
$reference_feature->insert();
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature
symbol: x-ray
synonyms: none
mRNA Feature
exon:
start: 1703
end: 1900
strand: 1
srcFeature_id: Id of genomic sample
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature
symbol: x-men
synonyms: wolverine
mRNA Feature
exon_1:
start: 12648
end: 13136
strand: 1
srcFeature_id:
Id of genomic sample
1) Enter the information about the following three novel genes, including the associated mRNA structures, into your database. Print the assigned feature_id for each inserted gene.
Gene Feature
symbol: xfile
synonyms: mulder, scully
description: A test gene for GMOD meeting
mRNA Feature
exon_1:
start: 13691
end: 13767
strand: 1
srcFeature_id: Id of genomic sample
exon_2:
start: 14687
end: 14720
strand: 1
srcFeature_id: Id of genomic sample
symbol: xfile
synonyms: mulder, scully
description: A test gene for GMOD meeting
...
my $gene_feature = new Modware::Feature(
-type => 'gene',
-name => 'xfile',
-description => 'A test gene for GMOD meeting',
-source => 'GMOD 2007 Demo'
);
$gene_feature->add_synonym( 'mulder' );
$gene_feature->add_synonym( 'scully' );
# inserts object into database
$gene_feature->insert();
print 'Inserted gene with feature_id:'.$gene_feature->feature_id()."\n";
exon_1:
start: 13691
end: 13767
strand: 1
srcFeature_id: Id of genomic sample
exon_2:
start: 14687
end: 14720
strand: 1
srcFeature_id: Id of genomic sample
# First, create exon features (using Bioperl)
my $exon_1 = new Bio::SeqFeature::Gene::Exon (
-start => 13691,
-end => 13767,
-strand => 1,
-is_coding => 1
);
my $exon_2 = new Bio::SeqFeature::Gene::Exon (
-start => 14687,
-end => 14720,
-strand => 1,
-is_coding => 1
);
# Next, create transcript feature to 'hold' exons (using Bioperl)
my $bioperl_mrna = new Bio::SeqFeature::Gene::Transcript();
# Add exons to transcript (using Bioperl)
$bioperl_mrna->add_exon( $exon_1 );
$bioperl_mrna->add_exon( $exon_2 );
The BioPerl object holds the location information, but now we want to create a Modware object and link it to the gene as well as locate it on the chromosome.
# Now create Modware Feature to 'hold' bioperl object
my $mrna_feature = new Modware::Feature(
-type => 'mRNA',
-bioperl => $bioperl_mrna,
-source => 'GMOD 2007 Demo',
-reference_feature => $reference_feature
);
# Associate mRNA to gene (required for insertion)
$mrna_feature->gene( $gene_feature );
# inserts object into database
$mrna_feature->insert();
2) Retrieve and print the following report for gene xfile
symbol: xfile
synonyms: mulder, scully
description: A test gene for GMOD meeting
type: gene
exon1 start: 13691
exon1 end: 13767
exon2 start: 14687
exon2 end: 14720
>xfile cds
ATGGCGTTAGTATTCATGGTTACTGGTTTCGCTACTGATATCACCCAGCGTGTAGGCTGT
GGAATCGAACACTGGTATTGTATAAATGTTTGTGAATACACTGAGAAATAA
Create new package, GMODWriter, to write the report, this package uses Modware and Bioperl methods.
use Modware::Gene;
use GMODWriter;
my $xfile_gene = new Modware::Gene( -name => 'xfile' );
GMODWriter->Write_gene_report( $xfile_gene );
2) Retrieve and print the following report for gene xfile
package GMODWriter;
sub Write_gene_report {
my ($self, $gene) = @_;
my $symbol = $gene->name();
my @synonyms = @{ $gene->synonyms() };
my $syn_string = join ",", @synonyms;
my $description = $gene->description();
my $type = $gene->type();
# get features associated with the gene that are of type 'mRNA'
my ($mrna) = grep { $_->type() eq 'mRNA' } @{ $gene->features() };
# use bioperl method to get exons from mRNA
my @exons = $mrna->bioperl->exons_ordered();
# Modware will return a nice fasta file for you.
my $fasta = $mrna->sequence( -type => 'cds', -format => 'fasta' );
# Now print the actual report
print "symbol: $symbol\n";
print "synonyms: $syn_string\n";
print "description: $description\n";
print "type: $type\n";
my $count = 0;
foreach my $exon (@exons ) {
$count++;
print "exon${count} start: ".$exon->start()."\n";
print "exon${count} end: ".$exon->end()."\n";
}
print "$fasta";
}
. . .
3) Update the gene xfile: change the name symbol to x-file and retrieve the changed record. Regenerate gene report
use Modware::Gene;
use Modware::DBH;
use GMODWriter;
eval{
# get xfile gene
my $xfile_gene = new Modware::Gene( -name => 'xfile' );
# change the name
$xfile_gene->name( 'x-file' );
# write changes to database
$xfile_gene->update();
# we can use the original object if we want, but instead
# we refetch from the database to 'prove' the name has been changed
my $xfile_gene2 = new Modware::Gene( -name => 'x-file' );
# use our GMODWriter package to write report for x-file
GMODWriter->Write_gene_report( $xfile_gene2 );
};
if ($@){
warn $@;
new Modware::DBH->rollback();
}
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis
1324 x-men Xenopus laevis
1325 x-ray Xenopus laevis
use Modware::Gene;
use Modware::DBH;
use GMODWriter;
# find genes starting with 'x-'
my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results
GMODWriter->Write_search_results( $results )
4) Search for all genes with symbols starting with "x-*". With the results produce the following simple result list (organism will vary):
1323 x-file Xenopus laevis
1324 x-men Xenopus laevis
1325 x-ray Xenopus laevis
sub Write_search_results {
my ($self, $itr) = @_;
# loop through iterator
while (my $gene = $itr->next) {
# print the requested information
print $gene->feature_id . "\t" . $gene->name .
"\t" . $gene->organism_name . "\n";
}
}
5) Delete the gene x-ray. Run the search and report again.
1323 x-file Xenopus laevis
1324 x-men Xenopus laevis
# get the xray gene
my $xray = new Modware::Gene( -name => 'x-ray' );
# set is_deleted = 1, this will 'hide' the gene from searches,
# also sets the is_available to 0, the gene is no longer visible
# to a search.
$xray->is_deleted(1);
# write change to database
$xray->update();
# find genes starting with 'x-'
my $results = Modware::Search::Gene->Search_by_name( 'x-*' );
# write the search results
GMODWriter->Write_search_results( $results )
set_connection