Trichloroacetate and nucleic acids
Michelle Gleeson
michelle at MOLECULE.BIO.UTS.EDU.AU
Mon Mar 22 23:34:16 EST 1999
Hi Emir,
Chloroform might work for your purposes - it should kill the bacteria very
quickly, and won't damage the DNA. However, the catch is that the
culture vessels, plates etc will need to be glass not plastic. Check out
some bacteriophage isolation methods for the details.
AATAGGCAATGGGCCCCATATAGGAACACAGAGCTGCATGCGTATTGCATGCCAGGCTATTCATTCCAGGGAAA
Michelle Gleeson
Molecular Parasitology Unit Ph: (02) 9514 4043
University of Technology Fax:(02) 9514 4003
Westbourne St Gore Hill, NSW 2065 michelle.gleeson at uts.edu.au
AUSTRALIA
TTATCCGTTACCCGGGGTATATCCTTGTGTCTCGACGTACGCATAACGTACGGTCCGATAAGTAAGGTCCCTTT
On 1999年3月23日, Emir Khatipov wrote:
> Does anybody know whether trichloroacetate will destroy DNA and (more
> importantly) RNA if used for rapid quenching of bacterial cells for further
> analysis.
>> The story is that I need a way to very rapidly and quantitatively isolate
> total bacterial RNA. Conventional methods requiring centrifuging off cells
> are too slow - seconds matter, and 1 min. will be too long. Since
> biochemists use trichloroacetate of chlorate to denature protein and thus
> instantly kill the cells, I thought that those acids can be useful. However,
> I am not shore that the acids will not destroy (hydrolyse,...) NAs. What
> about alkali?
>> I will appreciate everybody's considerations on the matter. Quenching with
> azyde does not look a solution, azyde will inhibit respiration, but not
> nucleases...
> Thank you
> Emir
>>>>>
More information about the Methods
mailing list
Send comments to us at biosci-help [At] net.bio.net