Engineering of Promoter Replacement Cassettes for Fine-Tuning of Gene Expression in Saccharomyces cerevisiae
Elke Nevoigt
Jessica Kohnke
Curt R Fischer
Hal Alper
Ulf Stahl
Gregory Stephanopoulos
Corresponding author. Mailing address: Department of Chemical Engineering, Massachusetts Institute of Technology, 77 Massachusetts Avenue, Cambridge, MA 02139. Phone: (617) 258-0398. Fax: (617) 253-3122. E-mail: gregstep@mit.edu.
Received 2006 Mar 6; Accepted 2006 Apr 21.
Abstract
The strong overexpression or complete deletion of a gene gives only limited information about its control over a certain phenotype or pathway. Gene function studies based on these methods are therefore incomplete. To effect facile manipulation of gene expression across a full continuum of possible expression levels, we recently created a library of mutant promoters. Here, we provide the detailed characterization of our yeast promoter collection comprising 11 mutants of the strong constitutive Saccharomyces cerevisiae TEF1 promoter. The activities of the mutant promoters range between about 8% and 120% of the activity of the unmutated TEF1 promoter. The differences in reporter gene expression in the 11 mutants were independent of the carbon source used, and real-time PCR confirmed that these differences were due to varying levels of transcription (i.e., caused by varying promoter strengths). In addition to a CEN/ARS plasmid-based promoter collection, we also created promoter replacement cassettes. They enable genomic integration of our mutant promoter collection upstream of any given yeast gene, allowing detailed genotype-phenotype characterizations. To illustrate the utility of the method, the GPD1 promoter of S. cerevisiae was replaced by five TEF1 promoter mutants of different strengths, which allowed analysis of the impact of glycerol 3-phosphate dehydrogenase activity on the glycerol yield.
In both functional genomics and metabolic engineering, strategies for fine-tuning gene expression are required to study the control exerted by target genes on phenotypes or metabolic fluxes of interest. Traditionally, gene expression varies among three conditions: (i) the wild type, (ii) the gene knockout, and (iii) strong overexpression of the target gene. However, several examples where the optimization of target phenotypes was achieved by moderate rather than strong multicopy expression of a target gene have been given (12, 13, 30). These examples highlight the need for tools that enable the fine-tuning and precise control of gene expression in Saccharomyces cerevisiae.
Several strategies have been explored to obtain a graded target gene expression. One strategy is to clone native promoters of various strengths to drive the expression of a desired gene (34). However, this method is not robust, since endogenous promoters may be subject to different regulation modalities, even despite their designation as "constitutive." Moreover, a native promoter of a given desired strength may be unavailable or difficult to identify. A second strategy uses vectors of different copy numbers to adjust gene expression levels (12, 13, 30). This approach is limited by the availability of plasmids of any given desired copy number. Other problems with this technique are the metabolic burden associated with maintenance of high-copy number plasmids and the cell-cell heterogeneity in expression caused by copy number variance between single cells of a culture. A third strategy for modulating gene expression has been to titrate an inducible promoter system with various concentrations of its inducer (11, 25). However, inducible systems often suffer from inducer toxicity and inducer-mediated pleiotropic effects. Furthermore, the use of most inducers is prohibitively expensive at industrial scales. Cell-cell heterogeneity is a problem with this strategy, as well, because it is not clear that the level of induction is homogeneous in all cells of a population. For example, a single-cell level investigation of an inducible (araBAD) promoter in Escherichia coli uncovered the fact that the dose response of reporter gene expression to increasing inducer concentration was actually due to an increasing fraction of induced versus uninduced cells (21). A final strategy for manipulating gene expression has been the creation of artificial promoter libraries. This strategy has been implemented mainly in bacteria (2, 9, 28). There is also one example in which a synthetic promoter library was created in yeast; however only three members of this library were chosen for further study (11). To date, no broad-range, well-characterized promoter collection is available for yeast which can be used directly in the replacement of any promoter in the yeast genome.
Our laboratory recently described the creation of a promoter library in yeast (2) in which promoters of gradually increasing strength were generated by subjecting the TEF1 (translation and elongation factor 1) promoter of S. cerevisiae to error-prone PCR. TEF1 promoter mutants with defined activities were selected. The present study describes the further characterization of the TEF1 promoter mutant collection, the generation of promoter replacement cassettes for genomic integration, and its utility for metabolic pathway analysis.
MATERIALS AND METHODS
Strains, cultivation conditions, and reagents.
The yeast strain BY4741 (MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0) (created by Brachmann et al. [4a]) was obtained from EUROSCARF, Frankfurt, Germany. Escherichia coli DH5α (Maximum Efficiency DH5α Chemically Competent E. coli; Invitrogen, Carlsbad, CA) was used for retransformation of yeast plasmid DNA.
Yeast and bacterial strains were stored in 20% glycerol at −70°C. E. coli was grown in Luria-Bertani medium. Ampicillin at 100 μg/ml was added to the medium when required. Yeast strain BY4741 without plasmid was cultivated in YPD medium (10 g of yeast extract/liter, 20 g of Bacto Peptone/liter, and 20 g glucose/liter). To select and grow yeast transformants using either URA3 or LEU2 as a selectable marker, we used a yeast synthetic complete (YSC) medium containing 6.7 g of Yeast Nitrogen Base (Difco)/liter, 20 g glucose/liter, and a mixture of appropriate nucleotide bases and amino acids (CSM-URA or CSM-LEU [Qbiogene, Irvine, CA], respectively), resulting in YSC Leu− or YSC Ura−. For the growth experiments using a respiratory carbon source, 2% ethanol and 2% glycerol were added to the medium instead of 2% glucose. Solid media were as described above but with 1.5% agar. Yeast cells were routinely cultivated at 30°C in Erlenmeyer flasks closed with cotton plugs and shaken at 200 rpm (semiaerobic conditions) without pH control.
Taq polymerase was obtained from New England Biolabs (Beverly, MA). Primers used for PCR and sequencing were purchased from Invitrogen (Carlsbad, CA).
Retransformation of plasmid DNA.
The generation of the CEN/ARS plasmid-based yECitrine reporter plasmid, the cloning and error-prone PCR of the S. cerevisiae TEF1 promoter using primers 1 and 2 (Table 1), and the fluorescence-activated cell sorting selection of 11 yeast clones exhibiting graded levels of specific reporter protein fluorescence have been described elsewhere (2). Isolation of plasmid DNAs from these selected yeast clones was performed using the Zymoprep Yeast Plasmid Miniprep Kit (ZYMO Research, Orange, CA), and 2.5 ml of DNA samples were transformed into 50 ml Maximum Efficiency DH5α competent cells (Invitrogen, Carlsbad, CA) following the instructions of the manufacturer.
TABLE 1.
Primers used
| Use/name | Sequence | |
|---|---|---|
| Error-prone PCR of TEF1 promoter | ||
| P1 | ATTGGGACAACACCAGTGAATAATTCTTCACCTTTAGACATTTTTCT | |
| P2 | ACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGC | |
| Real-time reverse transcription PCR of yECitrine mRNA | ||
| P3 | ATGGCTGACAAACAAAAGAATG | |
| P4 | CAGATTGATAGGATAAGTAATG | |
| Integration of both selectable genetic markersa | ||
| Forward primerb | ||
| P5 | TACGCCAAGCGCGCAATTAACCCTCACTAAAGGGAACAAAAGCTGCAGCTGAAGCTTCGTACGC | |
| Reverse primerc | ||
| P6a (unmutated TEF1p and mutant 11) | AAAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6b (mutant 2) | AAAACCTGGAGGAGTAAAGGGGGAGCCGAAGCACTTTAGAGCCGTGCATAGGCCACTAGTGGATCT | |
| P6c (mutant 6) | AAAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTCTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6d (mutant 8) | AAGATCTGGAAGAGTAAAAGAGGAGTAGAAACGTTTCGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6e (mutants 5 and 7) | AAAATCTGGAAGAGTAAAAAAGGAGTAGAGACATTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6f (mutant 12) | AGAATCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6g (mutant 9) | AAAGTCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6h (mutant 4) | AAAATCTGGAAGAGTAAAAAGGGGGTAGAAGCGTTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6i (mutant 10) | AAAATCTGGAAGAGTAACAAAGGAGTAGAAACATTTTGAAGCTATGCATAGGCCACTAGTGGATCT | |
| P6j (mutant 3) | AAAATCTGGAAGAGTAAAGAAGGAGTAGAAACATTTTGAGGCTATGCATAGGCCACTAGTGGATCT | |
| Genomic integration of TEF1 promoter versions upstream of GPD1 gene (Fig. 4) | ||
| Forward primerb | ||
| P7 | TCGTTACTCCGATTATTTTGTACAGCTGATGGGACCTTGCCGTCTCAGCTGAAGCTTCGTACGC | |
| Reverse primerc | ||
| P8a (unmutated TEF1p and mutants 3, 5, 6, 7, 9, 10, and 11) | AGCATTCAAGTGGCCGGAAGTTAAGTTTAATCTATCAGCAGCAGCAGACATTTTTCTAGAAAACTTAG | |
| P8b (mutant 2) | AGCATTCAAGTGGCCGGAAGTTAAGTTTAATCTATCAGCAGCAGCAGACATTTTTCTAGAAAACTTGG | |
| P8c (mutant 4) | AGCATTCAAGTGGCCGGAAGTTAAGTTTAATCTATCAGCAGCAGCAGACATTTTTCTAGAGAACTTAG | |
| P8d (mutant 8) | AGCATTCAAGTGGCCGGAAGTTAAGTTTAATCTATCAGCAGCAGCAGACATTTTTCTAAAAAACTTAG | |
| P8e (mutant 12) | AGCATTCAAGTGGCCGGAAGTTAAGTTTAATCTATCAGCAGCAGCAGACATTTTTCTAGAAGACTTAG | |
| PCR diagnosis of genomic integration of TEF1 promoter versions upstream of GPD1 gene | ||
| P9 (binds upstream GPD1 promoter) | CCCAAGGCAGGACAGTTACC | |
| P10 (binds in GPD1 coding sequence) | AGCACCAGATAGAGCACCACA | |
| P11 (binds in K.l.LEU2) | GGACCACCAACAGCACCTAGT | |
loxP-K.l.LEU2-loxP and loxP-KanMX-loxP, upstream of the CEN/ARS plasmid-based TEF1 promoter mutant collection.
Used for both the unmutated TEF1 promoter and all mutant versions.
Varies with regard to TEF1 mutants.
Reporter protein fluorescence measurement.
Measurements of specific fluorescence were performed using cells harvested from the logarithmic phase during growth in shake flasks. The fluorescence of yECitrine (27) was measured in diluted cultures (optical density at 600 nm [OD600], between 0.1 and 0.3) in cuvettes using a fluorescence spectrometer (HITACHI F-2500) with an excitation wavelength of 502 nm and an emission wavelength of 532 nm. The specific fluorescence is referred to here as the ratio of the fluorescence level measured and the OD600 measured in the same cuvette.
Reporter mRNA quantification. Total yeast RNA was extracted using the RiboPureTM-Yeast Kit (AMBION), including DNase treatment. The RNA concentration was quantified by absorbance at 260 nm. Quantification of yECitrine mRNA was performed using the iSciptTM One-Step RT-PCR Kit with SYBR Green (Bio-Rad) according to the manufacturer's instructions and an iCycler (Bio-Rad). We used 100 ng total yeast RNA in one reverse transcription (RT)-PCR. Primers P3 and P4 (Table 1) were used in RT-PCR. Data were analyzed using the iCycler software (Bio-Rad Laboratories, Hercules, CA).
Construction of plasmids usable as templates for generating promoter replacement cassettes.
To introduce the selectable and removable markers loxP-K.l.LEU2-loxP and loxP-KanMX-loxP upstream of the different TEF1 promoter versions in the CEN/ARS plasmids, the two marker cassettes were amplified by PCR using plasmids pUG6 (8) and pUG73 (7), respectively, as templates. Primers P5/P6a-j (Table 1) were designed for introducing the selectable markers by recombination-based cloning (22). PCR conditions were 95°C for 45 seconds, 54°C for 1 min, and 72°C for 2 min. PCR was performed for 25 cycles. The elongation time in the last cycle was 15 min. The 12 purified PCR fragments, together with the 12 SacI-linearized CEN/ARS plasmids bearing the corresponding TEF1 promoter versions, were transformed into competent cells of strain BY4741 (Frozen-EZ Yeast Transformation II; ZYMO RESEARCH, Orange, CA).
Genomic integration of the TEF1 promoter mutant collection upstream GPD1 coding sequence.
Promoter replacement cassettes were amplified by PCR from the CEN/ARS plasmid-based TEF1 promoter collection containing the loxP-K.l.LEU2-loxP selectable genetic marker (see Fig. 4). PCR was carried out using the forward primer P7 and the reverse primer 8a-e (Table 1) equipped with appropriate flanking sequences for integration of the PCR-amplified cassette by homologous recombination. PCR conditions were as described above, except that primer annealing was carried out at 52°C. The PCR products were ethanol precipitated, and about 0.5 μg was transformed into 10 μl of competent yeast cells of strain BY4741 (Frozen-EZ Yeast Transformation II; ZYMO RESEARCH, Orange, CA).
FIG. 4.
Impacts of specific GPDH activity on glycerol and biomass yields in S. cerevisiae. The values obtained by genomic integration of five TEF1 promoter versions (open symbols) and the previously known values of (i) GPD1 wild type, (i) deletion, and (iii) multicopy overexpression (closed symbols) are shown. Samples for measuring glycerol, biomass, and glucose for the calculation of yields (YX/S) were taken at the beginning of the fermentation and during logarithmic growth (optical densities were between 1.5 and 1.9). Experiments were carried out in shake flask cultures in a synthetic medium containing 2% glucose (YSC Leu−). YP/S, product yield. Error bars represent the standard deviations for two or more independent experiments.
Correct genomic integration of TEF1 promoter versions was confirmed by PCR diagnosis using two pairs of primers, i.e., P9/P10 and P11/P10 (Table 1). PCR conditions were the same as for the amplification of promoter replacement cassettes (see above), except that the annealing temperature was 60°C and PCR was performed for 30 cycles.
Determination of specific GPDH activity, glycerol, and glucose.
Glycerol 3-phosphate dehydrogenase (GPDH) activity was measured in cells growing logarithmically in YSC Leu− as previously described (19). Measurements of glycerol and glucose were performed with kits from r-Biopharm (Darmstadt, Germany). Cumulative yields of glycerol (and biomass) on glucose were determined by dividing the net amount of glycerol (or biomass) formed by the net amount of glucose depleted.
RESULTS
Characterization of the TEF1 promoter mutant collection after retransformation of plasmids.
Recently, an S. cerevisiae TEF1 promoter mutant library comprising 14,000 clones was created by error-prone PCR and cloning of the randomly mutated TEF1 promoter variants upstream of a green fluorescent protein (GFP) reporter within a CEN/ARS plasmid. Using fluorescence-activated cell sorting, 11 yeast clones with gradually increasing fluorescences were sorted out of this library (2).
In order to confirm that the differences in specific fluorescence were caused by the mutations in the plasmid-based TEF1 promoter, the 11 plasmids were isolated and retransformed into yeast. After retransformation, the specific fluorescence of each clone was measured in logarithmically growing cells. The growth rates of the various mutants were all nearly identical, which is important for reliable comparison of specific GFP fluorescences. Two different synthetic media were used: one with 2% glucose and one with 2% ethanol and 2% glycerol as carbon sources. The carbon catabolism of S. cerevisiae aerobically grown in medium containing 2% glucose is respirofermentative, whereas it is fully repiratory in ethanol-glycerol medium. Figure 1 shows that the relative strengths of the TEF1 promoter mutants were independent of the two growth media tested. Promoter performance was also measured directly by quantitative RT-PCR for the reporter gene mRNA. These results were well correlated with the reporter gene protein levels as measured by specific fluorescence (Fig. 1). These results strongly support the hypothesis that the varying levels of reporter gene expression in all clones were indeed due to differences in basal transcriptional activity, i.e., caused by varying strengths of the different TEF1 promoter mutants. The selected promoters cover a range of activities from about 8 to 120% in comparison to the unmutated TEF1 promoter.
FIG. 1.
Characterization of promoter strengths in the different members of the TEF1 promoter mutant collection after retransformation of plasmids. Three different metrics are shown for each member of the promoter collection: (i) reporter expression at the protein level measured by specific fluorescence of GFP during growth in glucose as a carbon source, (ii) reporter expression at the mRNA level in cells grown in glucose medium measured by real-time PCR, and (iii) specific fluorescence of GFP during growth in ethanol-glycerol as carbon sources. All determinations were carried out using logarithmically growing cells (OD600, about 1.5). The data shown are mean values of at least two independent experiments and were normalized to the reference (unmutated TEF1 promoter; open symbol). The coefficients of variance (CV) were 7%, 19%, and 11%. These numbers are the standard deviation divided by the mean. The value for specific reporter fluorescence in ethanol-glycerol medium (19%) is highly biased by mutant 2, which has the lowest activity and a large standard deviation compared with the mean. If this point is removed, the average CV is 13.5% instead of 19%.
All 11 selected TEF1 promoter mutants were sequenced (Fig. 2). Until this sequencing step, we acted on the assumption that we had been working with the TEF2 promoter, since the plasmid p416-TEF used as a template for error-prone PCR of the TEF promoter (2) was described as containing the TEF2 promoter of S. cerevisiae (6, 17). However, it became obvious from the sequencing that the plasmid p416-TEF instead contains the promoter of the TEF1 gene, which does show a high degree of homology to the TEF2 promoter (26).
FIG. 2.
Multiple-sequence alignment of the unmutated TEF1 promoter (TEF1p; boldface) and the 11 selected TEF1 promoter mutants with graded activities. The normalized promoter strength is shown for each mutant at the beginning of each mutant sequence. The stars mark those nucleotides which remained unchanged in all promoter versions, whereas mutations are highlighted. The underlined sequences correspond to the proposed transcription factor binding sites according to the literature (3).
The number of detected mutations within the mutated 401 bp of the TEF1 promoter (corresponding to the region from −412 to −11 of the native S. cerevisiae TEF1 promoter) ranged from 4 (mutant 10, whose activity is reduced to 78% of that of the unmutated TEF1 promoter) to 71 (mutant 2, exhibiting very low promoter activity). The mutations seemed to be fairly randomly distributed throughout the promoter sequence. However, a few positions were mutated in two or even three distinct mutants, but other regions remained completely untouched, especially the very 3′ end of the promoter (Fig. 2). Interestingly, mutant promoter 6, which showed a higher activity than the unmutated TEF1 promoter, had only a single-nucleotide deletion at position −251. By deleting the single guanine at this position, a continuous string of 10 adenines was generated, a fact which may contribute to the increased activity compared to the unmutated TEF1 promoter.
Generation of promoter replacement cassettes.
In our prior work, promoter delivery into the genome was a prerequisite for obtaining robust and reliable quantitative genotype-phenotype relationships (2). As such, we created a set of 12 promoter replacement cassettes which can be used to integrate into the yeast genome and regulate the expression of a desired gene. To obtain promoter replacement cassettes, it was necessary to clone a selectable genetic marker upstream of the TEF1 promoters in our plasmid library. We choose the markers loxP-K.l.LEU2-loxP (7), selectable by leucine prototrophy, and loxP-KanMX-loxP (8), selectable by resistance to the antibiotic geneticin G418. The markers are flanked by loxP sequences and therefore allow multiple usage of these replacement cassettes. Furthermore, the use of the KanMX selectable marker enables promoter replacement in industrial yeast strains that do not carry auxotrophic mutations. The 3′ ends of our primers P5 and P6a-j (Table 1), used for the recombination-based cloning of loxP-K.l.LEU2-loxP and loxP-KanMX-loxP into the region upstream of the promoters in our CEN/ARS-based plasmids, correspond to the 3′ ends of the unique primers previously designed to amplify a set of various selectable markers (7, 8) from the genetic marker plasmids available at EUROSCARF (http://web.uni-frankfurt.de/fb15/mikro/euroscarf/). Therefore, if required, other genetic markers can be integrated into the CEN/ARS derivatives to create alternate knockout cassettes for promoter insertion by using the same strategy described here (see Materials and Methods).
The integration of the selectable markers into the CEN/ARS plasmid-based TEF1 promoter collection had no significant impact on the activities of the TEF1 promoter mutants. Only slight variations in relative specific fluorescence were seen when the CEN/ARS plasmid-bearing clones were compared to the corresponding yeast clones containing a marker integration site. This slight variance is attributable to clonal variability.
Use of the TEF1 promoter collection to study control by GPD1 expression of glycerol production in S. cerevisiae.
Previous studies suggested that GPDH is the rate-limiting step in the glycerol biosynthetic pathway of S. cerevisiae (1, 4, 5, 16, 18, 19, 23). It has been shown that the deletion of GPD1, one of the two isogenes encoding GPDH, caused a reduction in glycerol production compared to the GPD1 wild type. Furthermore, the strong overexpression of GPD1 led to a significantly increased rate and yield of glycerol production. However, it has also been found that the multicopy overexpression of GPD1 had a negative impact on the growth rate and biomass yield (16, 18-20, 23, 24). Therefore, in order to obtain the simultaneous phenotypes of high biomass and glycerol yields, it is necessary to optimize the expression of GPD1. To do so, we used our TEF1 promoter collection to investigate gradually increasing levels of GPD1 expression. Five members of the TEF1 promoter library, including the weakest and strongest promoter mutants, as well as the unmutated TEF1 promoter, were integrated into the yeast genome upstream of the GPD1 gene (Fig. 3). For PCR amplification of the promoter replacement cassettes, the plasmid collection bearing loxP-K.l.LEU2-loxP as a selectable marker was chosen. The PCR diagnostics of the LEU2 prototrophic transformants revealed that more than 90% of the clones showed the correct integration, highlighting the high efficiency of this method.
FIG. 3.
Genomic integration of five TEF1 promoter versions (the unmutated TEF1 promoter and four mutants) upstream of the GPD1 gene in S. cerevisiae. (A) Strategy of promoter replacement. (B) Activities of GPDH in the yeast transformants, depending on promoter strength. Promoter strength was calculated as the mean value of two different metrics shown in Fig. 1, i.e., relative reporter fluorescence and relative mRNA levels. Error bars indicate the range between normalized mRNA and normalized fluorescence for each promoter.
The specific GPDH activities of the verified transformants were measured and normalized to the activity obtained with the unmutated TEF1 promoter and plotted as a function of the promoter strength (Fig. 3). The values for promoter strength were obtained by calculating the mean values of the two metrics of relative reporter expression, i.e., fluorescence and transcript level, as measured in the CEN/ARS plasmid-based promoter collection. This promoter strength metric is analogous to the metric used for our previously reported E. coli library (2). A linear correlation, with a similar dynamic range, was obtained between relative promoter strength and relative GPDH activity (Fig. 3).
Both glycerol and biomass yields were measured in the five integrated transformants and plotted as a function of specific GPDH activity (Fig. 4). These results are contrasted with the three data points we obtained from a GPD1 deletion mutant, from a strain overexpressing GPD1, from a 2μm-based multicopy plasmid, and from the wild-type background strain (Fig. 4). This illustrates the new information obtained by the promoter collection versus the limited data points accessible without using it. The curve for the glycerol yield shows that the glycerol yield depends linearly on GPDH activity in the range of activities obtained by the members of our TEF1 promoter mutant collection. These results support previous assertions that GPDH constitutes a rate-limiting step in the synthesis of glycerol. However, the data also suggest that this linear dependence does not continue indefinitely and saturates well before reaching the level obtained in multicopy overexpression of GPD1. Moreover, biomass formation was significantly reduced in the transformant bearing the overexpression plasmid. However, the moderate increase in GPDH activity obtained by using members of our TEF1 promoter collection allowed an increase in glycerol yields without having an adverse effect on growth. Indeed, moderate GPDH overexpression may even have positively affected biomass formation.
DISCUSSION
A collection of TEF1 promoter mutants of various strengths for S. cerevisiae (2) was retransformed, rigorously characterized, and found to provide a robust tool for controlling gene expression. Furthermore, the relative strengths of these promoters were unaffected by the carbon source. Measurement of reporter mRNA confirmed that yECitrine fluorescence correlated with transcript levels and can be used as a measurement of promoter strength (assuming that the half-lives are the same for all 12 yECitrine mRNAs generated by our TEF1 promoter collection).
The sequence analysis of the TEF1 promoter mutants showed high variance in both the locations and densities of the mutated residues. A few mutations were overrepresented in a number of mutants; however, the number of TEF1 promoter mutants investigated here is too low to infer reliably which mutations have positive, negative, or zero impact on promoter activity, using the algorithm developed by Jensen et al. (unpublished data). Mutations were seen to affect the known transcription factor binding sites UASrpg (Rap1p) and CT-Box (Gcr1p) (3), but many mutations were outside of known binding sites. The highest number of mutations (including those within the promoter motifs mentioned above) was observed in mutant 2, which had the lowest promoter activity. The TEF1 promoter mutant 6 showed only six point mutations and exhibited the highest promoter activity, even higher than that of the unmutated TEF1 promoter. It was also interesting that a single guanidine deletion at position −251 gave rise to a string of 10 adenosines. The importance of this mutation over the remaining five mutations in this mutant could be ascertained definitively only by site-directed mutagenesis and further analysis of the resulting promoters.
By cloning two different selectable markers (loxP-K.l.LEU2-loxP and loxP-KanMX-loxP) upstream of the TEF1 promoter mutants, we provided two additional plasmid collections that can be used as templates for PCR amplification of promoter replacement cassettes. The integration of a promoter in front of a gene in the genome can overcome problems associated with expression from promoters on a plasmid (32). Moreover, the integrative approach abolishes the promotion of target gene expression from its native promoter and any associated regulation modalities, which allows a more accurate assessment of genotype-phenotype characterization. The use of KanMX as a selectable marker allows the application of this promoter collection in industrial yeasts lacking auxotrophies. The loxP sequences flanking the genetic markers enable rescue of the marker and, hence, multiple use of the replacement cassettes. Such multiple replacements are necessary for most metabolic-engineering applications, in which the expression levels of many pathway enzymes have to be optimized to obtain a maximum flux (15).
The collection of promoter replacement cassettes offers the opportunity to analyze the level of control of any enzyme activity on metabolic fluxes or phenotypes. Here, the promoter replacement cassettes were used to vary levels of cytosolic GPDH activities by integrating the TEF1 promoter mutant collection upstream of the GPD1 gene in the yeast genome. The linear correlation between promoter strength calculated from plasmid-based reporter gene expression and the specific GPDH activity reflecting GPD1 gene expression highlights two important characteristics of this integration system: (i) the relative strengths of our promoters were unaffected by the genomic integration and (ii) an increase in the promoter strength of a gene resulted in an equal increase in activity in the enzyme encoded by that gene.
Moreover, our analysis indicated that GPD1 was transcriptionally controlled. The use of this promoter collection upstream of other genes in the future will certainly reveal enzymes whose activities vary nonlinearly with promoter strength, especially if posttranslational control prevails.
Another aspect of promoter replacement analysis that will vary with the target gene under investigation is the expression levels of the library members relative to the wild-type level. This difference is due to differences in the endogenous levels of gene transcription, which can vary by orders of magnitude between genes. In the case of GPD1 gene expression, some members of our promoter collection caused a specific GPDH activity lower than the wild-type level, and some others members caused a higher activity. It is conceivable that for a gene with very low expression in the wild type, the weakest promoter of our collection could cause overexpression. We are currently working on increasing the dynamic range of the TEF1 promoter collection to extend its utility. The challenge of isolating very weak promoters lies in the fact that a GFP reporter is not sensitive enough for this task.
The rate-limiting role of GPDH for glycerol production in S. cerevisiae was confirmed by this analysis, at least in the range of GPDH activities up to twice the wild-type level (Fig. 4). However, the result of our detailed analysis of GPD1 control on the glycerol pathway illustrates that the regime in which this linear dependence is observed does not extend to strong overexpression. As a result, the correlation between glycerol production and GPDH activity saturates at levels below the value of multicopy strong overexpression. Moreover, this multicopy overexpression resulted in a decreased biomass yield. A negative impact on the growth rate associated with the strong overexpression of GPD1 has been observed in several independent studies (16, 18-20, 23, 24) and traced back to acetaldehyde accumulation and net ATP loss. However, interpolation of our data (Fig. 4) suggests that a GPDH activity of about 0.5 to 0.6 U/mg protein is the optimal enzyme activity level to obtain maximal glycerol yield without adversely impacting growth. It can be postulated that this GPDH activity could be obtained by integrating two copies of the strongest TEF1 mutant promoter (mutant 6). This information could be useful if overexpression of GPD1 has to be achieved by an integrative, instead of a plasmid-based, approach.
The promoter collection provided here should be a useful tool for both basic and applied research in metabolic-pathway analysis and functional genomics, as highlighted by our investigation of glycerol yield. Finally, it has been noted that the promoter sequences of the genes coding for the translation and elongation factors are highly conserved among yeasts and even hyphal fungi (14, 29) and, therefore, are functional across species borders. In bacteria, a library created for Lactococcus lactis was seen to be functional in E. coli (10). In fungi, it has been shown that the TEF2 promoter of the fungus Ashbya gossypii is functional in S. cerevisiae (33) and the TEF1 promoter of the nonconventional yeast Arxula adeninivorans is functional in S. cerevisiae and several non-Saccharomyces yeasts of biotechnological interest (31). Therefore, it may be possible to use our TEF1 promoter collection in other yeast species or hyphal fungi as well, a hypothesis which must be tested in the future.
Acknowledgments
This work was supported by the Berliner Programm zur Förderung der Chancengleichheit von Frauen in Forschung und Lehre, the DuPont-MIT Alliance, and Department of Energy grant DE-FG02-99ER15015.
REFERENCES
- 1.Albertyn, J., S. Hohmann, J. M. Thevelein, and B. A. Prior. 1994. GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14:4135-4144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Alper, H., C. Fischer, E. Nevoigt, and G. Stephanopoulos. 2005. Tuning genetic control through promoter engineering. Proc. Natl. Acad. Sci. USA 102:12678-12683. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bi, X., and J. R. Broach. 1999. UASrpg can function as a heterochromatin boundary element in yeast. Genes Dev. 13:1089-1101. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bjorkqvist, S., R. Ansell, L. Adler, and G. Liden. 1997. Physiological response to anaerobicity of glycerol-3-phosphate dehydrogenase mutants of Saccharomyces cerevisiae. Appl. Environ. Microbiol. 63:128-132. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4a.Brachmann, C. B., A. Davies, G. J. Cost, E. Caputo, J. Li, P. Hieter, and J. D. Boeke. 1998. Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14:115-132. [DOI] [PubMed]
- 5.Cronwright, G. R., J. M. Rohwer, and B. A. Prior. 2002. Metabolic control analysis of glycerol synthesis in Saccharomyces cerevisiae. Appl. Environ. Microbiol. 68:4448-4456. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Funk, M., R. Niedenthal, D. Mumberg, K. Brinkmann, V. Ronicke, and T. Henkel. 2002. Vector systems for heterologous expression of proteins in Saccharomyces cerevisiae. Methods Enzymol. 350:248-257. [DOI] [PubMed] [Google Scholar]
- 7.Gueldener, U., J. Heinisch, G. J. Koehler, D. Voss, and J. H. Hegemann. 2002. A second set of loxP marker cassettes for Cre-mediated multiple gene knockouts in budding yeast. Nucleic Acids Res. 30:e23. [Online.] [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Guldener, U., S. Heck, T. Fielder, J. Beinhauer, and J. H. Hegemann. 1996. A new efficient gene disruption cassette for repeated use in budding yeast. Nucleic Acids Res. 24:2519-2524. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Jensen, P. R., and K. Hammer. 1998. Artificial promoters for metabolic optimization. Biotechnol. Bioeng. 58:191-195. [PubMed] [Google Scholar]
- 10.Jensen, P. R., and K. Hammer. 1998. The sequence of spacers between the consensus sequences modulates the strength of prokaryotic promoters. Appl. Environ Microbiol. 64:82-87. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Jeppsson, M., B. Johansson, P. R. Jensen, B. Hahn-Hagerdal, and M. F. Gorwa-Grauslund. 2003. The level of glucose-6-phosphate dehydrogenase activity strongly influences xylose fermentation and inhibitor sensitivity in recombinant Saccharomyces cerevisiae strains. Yeast 20:1263-1272. [DOI] [PubMed] [Google Scholar]
- 12.Jin, Y. S., H. Ni, J. M. Laplaza, and T. W. Jeffries. 2003. Optimal growth and ethanol production from xylose by recombinant Saccharomyces cerevisiae require moderate d-xylulokinase activity. Appl. Environ. Microbiol. 69:495-503. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jones, K. L., S. W. Kim, and J. D. Keasling. 2000. Low-copy plasmids can perform as well as or better than high-copy plasmids for metabolic engineering of bacteria. Metab. Eng. 2:328-338. [DOI] [PubMed] [Google Scholar]
- 14.Kitamoto, N., J. Matsui, Y. Kawai, A. Kato, S. Yoshino, K. Ohmiya, and N. Tsukagoshi. 1998. Utilization of the TEF1-alpha gene (TEF1) promoter for expression of polygalacturonase genes, pgaA and pgaB, in Aspergillus oryzae. Appl. Microbiol. Biotechnol. 50:85-92. [DOI] [PubMed] [Google Scholar]
- 15.Koffas, M. A., G. Y. Jung, and G. Stephanopoulos. 2003. Engineering metabolism and product formation in Corynebacterium glutamicum by coordinated gene overexpression. Metab. Eng. 5:32-41. [DOI] [PubMed] [Google Scholar]
- 16.Michnick, S., J. L. Roustan, F. Remize, P. Barre, and S. Dequin. 1997. Modulation of glycerol and ethanol yields during alcoholic fermentation in Saccharomyces cerevisiae strains overexpressed or disrupted for GPD1 encoding glycerol 3-phosphate dehydrogenase. Yeast 13:783-793. [DOI] [PubMed] [Google Scholar]
- 17.Mumberg, D., R. Muller, and M. Funk. 1994. Regulatable promoters of Saccharomyces cerevisiae: comparison of transcriptional activity and their use for heterologous expression. Nucleic Acids Res. 22:5767-5768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Nevoigt, E., R. Pilger, E. Mast-Gerlach, U. Schmidt, S. Freihammer, M. Eschenbrenner, L. Garbe, and U. Stahl. 2002. Genetic engineering of brewing yeast to reduce the content of ethanol in beer. FEMS Yeast Res. 2:225-232. [DOI] [PubMed] [Google Scholar]
- 19.Nevoigt, E., and U. Stahl. 1996. Reduced pyruvate decarboxylase and increased glycerol-3-phosphate dehydrogenase [NAD+] levels enhance glycerol production in Saccharomyces cerevisiae. Yeast 12:1331-1337. [DOI] [PubMed] [Google Scholar]
- 20.Nguyen, H. T., A. Dieterich, K. Athenstaedt, N. H. Truong, U. Stahl, and E. Nevoigt. 2004. Engineering of Saccharomyces cerevisiae for the production of l-glycerol 3-phosphate. Metab. Eng. 6:155-163. [DOI] [PubMed] [Google Scholar]
- 21.Patkar, A., N. Vijayasankaran, D. W. Urry, and F. Srienc. 2002. Flow cytometry as a useful tool for process development: rapid evaluation of expression systems. J. Biotechnol. 93:217-229. [DOI] [PubMed] [Google Scholar]
- 22.Raymond, C. K., T. A. Pownder, and S. L. Sexson. 1999. General method for plasmid construction using homologous recombination. BioTechniques 26:134-138, 140-141. [DOI] [PubMed] [Google Scholar]
- 23.Remize, F., L. Barnavon, and S. Dequin. 2001. Glycerol export and glycerol-3-phosphate dehydrogenase, but not glycerol phosphatase, are rate limiting for glycerol production in Saccharomyces cerevisiae. Metab. Eng. 3:301-312. [DOI] [PubMed] [Google Scholar]
- 24.Remize, F., J. L. Roustan, J. M. Sablayrolles, P. Barre, and S. Dequin. 1999. Glycerol overproduction by engineered Saccharomyces cerevisiae wine yeast strains leads to substantial changes in by-product formation and to a stimulation of fermentation rate in stationary phase. Appl. Environ. Microbiol. 65:143-149. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Robinson, A. S., J. A. Bockhaus, A. C. Voegler, and K. D. Wittrup. 1996. Reduction of BiP levels decreases heterologous protein secretion in Saccharomyces cerevisiae. J. Biol. Chem. 271:10017-10022. [DOI] [PubMed] [Google Scholar]
- 26.Schirmaier, F., and P. Philippsen. 1984. Identification of two genes coding for the translation elongation factor EF-1 alpha of S. cerevisiae. EMBO J. 3:3311-3315. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Sheff, M. A., and K. S. Thorn. 2004. Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21:661-670. [DOI] [PubMed] [Google Scholar]
- 28.Solem, C., and P. R. Jensen. 2002. Modulation of gene expression made easy. Appl. Environ. Microbiol. 68:2397-2403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Steiner, S., and P. Philippsen. 1994. Sequence and promoter analysis of the highly expressed TEF gene of the filamentous fungus Ashbya gossypii. Mol. Gen. Genet. 242:263-271. [DOI] [PubMed] [Google Scholar]
- 30.Tao, L., R. E. Jackson, and Q. Cheng. 2005. Directed evolution of copy number of a broad host range plasmid for metabolic engineering. Metab. Eng. 7:10-17. [DOI] [PubMed] [Google Scholar]
- 31.Terentiev, Y., A. H. Pico, E. Boer, T. Wartmann, J. Klabunde, U. Breuer, W. Babel, M. Suckow, G. Gellissen, and G. Kunze. 2004. A wide-range integrative yeast expression vector system based on Arxula adeninivorans-derived elements. J. Ind. Microbiol. Biotechnol. 31:223-228. [DOI] [PubMed] [Google Scholar]
- 32.Verstrepen, K. J., and J. M. Thevelein. 2004. Controlled expression of homologous genes by genomic promoter replacement in the yeast Saccharomyces cerevisiae. Methods Mol. Biol. 267:259-266. [DOI] [PubMed] [Google Scholar]
- 33.Wach, A., A. Brachat, R. Pohlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-1808. [DOI] [PubMed] [Google Scholar]
- 34.Yan, W., and E. A. Craig. 1999. The glycine-phenylalanine-rich region determines the specificity of the yeast Hsp40 Sis1. Mol. Cell. Biol. 19:7751-7758. [DOI] [PMC free article] [PubMed] [Google Scholar]