[Python-checkins] r54642 - sandbox/trunk/pybch/Tests/stringbench2.py

sean.reifschneider python-checkins at python.org
Sat Mar 31 23:26:28 CEST 2007


Author: sean.reifschneider
Date: Sat Mar 31 23:26:25 2007
New Revision: 54642
Added:
 sandbox/trunk/pybch/Tests/stringbench2.py (contents, props changed)
Log:
Adding files in preparation for removing pybch.
Added: sandbox/trunk/pybch/Tests/stringbench2.py
==============================================================================
--- (empty file)
+++ sandbox/trunk/pybch/Tests/stringbench2.py	Sat Mar 31 23:26:25 2007
@@ -0,0 +1,1199 @@
+
+# Various microbenchmarks comparing unicode and byte string performance
+
+import timeit
+import itertools
+import operator
+import re
+import sys
+import datetime
+import optparse
+from TestHelpers import Test
+
+REPEAT = 1
+REPEAT = 3
+#REPEAT = 7
+
+_RANGE_1000 = range(1)
+_RANGE_1000 = range(1)
+_RANGE_100 = range(1)
+_RANGE_10 = range(1)
+
+dups = {}
+def bench(s, group, repeat_count):
+ def blah(f):
+ if f.__name__ in dups:
+ raise AssertionError("Multiple functions with same name: %r" %
+ (f.__name__,))
+ dups[f.__name__] = 1
+ f.comment = s
+ f.is_bench = True
+ f.group = group
+ f.repeat_count = repeat_count
+ return f
+ return blah
+
+def uses_re(f):
+ f.uses_re = True
+
+####### 'in' comparisons
+
+ at bench('"A" in "A"*1000', "early match, single character", 1000)
+def in_test_quick_match_single_character(STR):
+ s1 = STR("A" * 1000)
+ s2 = STR("A")
+ for x in _RANGE_1000:
+ s2 in s1
+
+ at bench('"B" in "A"*1000', "no match, single character", 1000)
+def in_test_no_match_single_character(STR):
+ s1 = STR("A" * 1000)
+ s2 = STR("B")
+ for x in _RANGE_1000:
+ s2 in s1
+
+
+ at bench('"AB" in "AB"*1000', "early match, two characters", 1000)
+def in_test_quick_match_two_characters(STR):
+ s1 = STR("AB" * 1000)
+ s2 = STR("AB")
+ for x in _RANGE_1000:
+ s2 in s1
+
+ at bench('"BC" in "AB"*1000', "no match, two characters", 1000)
+def in_test_no_match_two_character(STR):
+ s1 = STR("AB" * 1000)
+ s2 = STR("BC")
+ for x in _RANGE_1000:
+ s2 in s1
+
+ at bench('"BC" in ("AB"*300+"C")', "late match, two characters", 1000)
+def in_test_slow_match_two_characters(STR):
+ s1 = STR("AB" * 300+"C")
+ s2 = STR("BC")
+ for x in _RANGE_1000:
+ s2 in s1
+
+ at bench('s="ABC"*33; (s+"E") in ((s+"D")*300+s+"E")',
+ "late match, 100 characters", 100)
+def in_test_slow_match_100_characters(STR):
+ m = STR("ABC"*33)
+ s1 = (m+"D")*300 + m+"E"
+ s2 = m+"E"
+ for x in _RANGE_100:
+ s2 in s1
+
+# Try with regex
+ at uses_re
+ at bench('s="ABC"*33; re.compile(s+"D").search((s+"D")*300+s+"E")',
+ "late match, 100 characters", 100)
+def re_test_slow_match_100_characters(STR):
+ m = STR("ABC"*33)
+ s1 = (m+"D")*300 + m+"E"
+ s2 = m+"E"
+ pat = re.compile(s2)
+ search = pat.search
+ for x in _RANGE_100:
+ search(s1)
+
+
+#### same tests as 'in' but use 'find'
+
+# XXX: TODO: Add rfind
+
+
+
+ at bench('("A"*1000).find("A")', "early match, single character", 1000)
+def find_quick_match_single_character(STR):
+ s1 = STR("A" * 1000)
+ s2 = STR("A")
+ s1_find = s1.find
+ for x in _RANGE_1000:
+ s1_find(s2)
+
+ at bench('("A"*1000).find("B")', "no match, single character", 1000)
+def find_test_no_match_single_character(STR):
+ s1 = STR("A" * 1000)
+ s2 = STR("B")
+ s1_find = s1.find
+ for x in _RANGE_1000:
+ s1_find(s2)
+
+
+ at bench('("AB"*1000).find("AB")', "early match, two characters", 1000)
+def find_test_quick_match_two_characters(STR):
+ s1 = STR("AB" * 1000)
+ s2 = STR("AB")
+ s1_find = s1.find
+ for x in _RANGE_1000:
+ s1_find(s2)
+
+ at bench('("AB"*1000).find("BC")', "no match, two characters", 1000)
+def find_test_no_match_two_character(STR):
+ s1 = STR("AB" * 1000)
+ s2 = STR("BC")
+ s1_find = s1.find
+ for x in _RANGE_1000:
+ s1_find(s2)
+
+ at bench('("AB"*300+"C").find("BC")', "late match, two characters", 1000)
+def find_test_slow_match_two_characters(STR):
+ s1 = STR("AB" * 300+"C")
+ s2 = STR("BC")
+ s1_find = s1.find
+ for x in _RANGE_1000:
+ s1_find(s2)
+
+ at bench('s="ABC"*33; ((s+"D")*500+s+"E").find(s)',
+ "late match, 100 characters", 100)
+def find_test_slow_match_100_characters(STR):
+ m = STR("ABC"*33)
+ s1 = (m+"D")*500 + m+"E"
+ s2 = m+"E"
+ s1_find = s1.find
+ for x in _RANGE_100:
+ s1_find(s2)
+
+#### Now with index.
+# Skip the ones which fail because that would include exception overhead.
+# Add rindex tests.
+
+
+ at bench('("A"*1000).index("A")', "early match, single character", 1000)
+def index_test_quick_match_single_character(STR):
+ s1 = STR("A" * 1000)
+ s2 = STR("A")
+ s1_index = s1.index
+ for x in _RANGE_1000:
+ s1_index(s2)
+
+
+ at bench('("AB"*1000).index("AB")', "early match, two characters", 1000)
+def index_test_quick_match_two_characters(STR):
+ s1 = STR("AB" * 1000)
+ s2 = STR("AB")
+ s1_index = s1.index
+ for x in _RANGE_1000:
+ s1_index(s2)
+
+ at bench('("AB"*300+"C").index("BC")', "late match, two characters", 1000)
+def index_test_slow_match_two_characters(STR):
+ s1 = STR("AB" * 300+"C")
+ s2 = STR("BC")
+ s1_index = s1.index
+ for x in _RANGE_1000:
+ s1_index(s2)
+
+ at bench('s="ABC"*33; ((s+"D")*500+s+"E").index(s)',
+ "late match, 100 characters", 100)
+def index_test_slow_match_100_characters(STR):
+ m = STR("ABC"*33)
+ s1 = (m+"D")*500 + m+"E"
+ s2 = m+"E"
+ s1_index = s1.index
+ for x in _RANGE_100:
+ s1_index(s2)
+
+#### Benchmark the operator-based methods
+
+ at bench('"A"*10', "repeat 1 character 10 times", 1000)
+def repeat_single_10_times(STR):
+ s = STR("A")
+ for x in _RANGE_1000:
+ s * 10
+
+ at bench('"A"*1000', "repeat 1 character 1000 times", 1000)
+def repeat_single_1000_times(STR):
+ s = STR("A")
+ for x in _RANGE_1000:
+ s * 1000
+
+ at bench('"ABCDE"*10', "repeat 5 characters 10 times", 1000)
+def repeat_5_10_times(STR):
+ s = STR("ABCDE")
+ for x in _RANGE_1000:
+ s * 10
+
+ at bench('"ABCDE"*1000', "repeat 5 characters 1000 times", 1000)
+def repeat_5_1000_times(STR):
+ s = STR("ABCDE")
+ for x in _RANGE_1000:
+ s * 1000
+
+# + for concat
+
+ at bench('"Andrew"+"Dalke"', "concat two strings", 1000)
+def concat_two_strings(STR):
+ s1 = STR("Andrew")
+ s2 = STR("Dalke")
+ for x in _RANGE_1000:
+ s1+s2
+
+ at bench('s1+s2+s3+s4+...+s20', "concat 20 strings of words length 4 to 15",
+ 1000)
+def concat_many_strings(STR):
+ s1=STR('TIXSGYNREDCVBHJ')
+ s2=STR('PUMTLXBZVDO')
+ s3=STR('FVZNJ')
+ s4=STR('OGDXUW')
+ s5=STR('WEIMRNCOYVGHKB')
+ s6=STR('FCQTNMXPUZH')
+ s7=STR('TICZJYRLBNVUEAK')
+ s8=STR('REYB')
+ s9=STR('PWUOQ')
+ s10=STR('EQHCMKBS')
+ s11=STR('AEVDFOH')
+ s12=STR('IFHVD')
+ s13=STR('JGTCNLXWOHQ')
+ s14=STR('ITSKEPYLROZAWXF')
+ s15=STR('THEK')
+ s16=STR('GHPZFBUYCKMNJIT')
+ s17=STR('JMUZ')
+ s18=STR('WLZQMTB')
+ s19=STR('KPADCBW')
+ s20=STR('TNJHZQAGBU')
+ for x in _RANGE_1000:
+ (s1 + s2+ s3+ s4+ s5+ s6+ s7+ s8+ s9+s10+
+ s11+s12+s13+s14+s15+s16+s17+s18+s19+s20)
+
+
+#### Benchmark join
+
+ at bench('"A".join("")',
+ "join empty string, with 1 character sep", 100)
+def join_empty_single(STR):
+ sep = STR("A")
+ s2 = STR("")
+ sep_join = sep.join
+ for x in _RANGE_100:
+ sep_join(s2)
+
+ at bench('"ABCDE".join("")',
+ "join empty string, with 5 character sep", 100)
+def join_empty_5(STR):
+ sep = STR("ABCDE")
+ s2 = STR("")
+ sep_join = sep.join
+ for x in _RANGE_100:
+ sep_join(s2)
+
+ at bench('"A".join("ABC..Z")',
+ "join string with 26 characters, with 1 character sep", 1000)
+def join_alphabet_single(STR):
+ sep = STR("A")
+ s2 = STR("ABCDEFGHIJKLMnOPQRSTUVWXYZ")
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+ at bench('"ABCDE".join("ABC..Z")',
+ "join string with 26 characters, with 5 character sep", 1000)
+def join_alphabet_5(STR):
+ sep = STR("ABCDE")
+ s2 = STR("ABCDEFGHIJKLMnOPQRSTUVWXYZ")
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+ at bench('"A".join(list("ABC..Z"))',
+ "join list of 26 characters, with 1 character sep", 1000)
+def join_alphabet_list_single(STR):
+ sep = STR("A")
+ s2 = list(STR("ABCDEFGHIJKLMnOPQRSTUVWXYZ"))
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+ at bench('"ABCDE".join(list("ABC..Z"))',
+ "join list of 26 characters, with 5 character sep", 1000)
+def join_alphabet_list_five(STR):
+ sep = STR("ABCDE")
+ s2 = list(STR("ABCDEFGHIJKLMnOPQRSTUVWXYZ"))
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+ at bench('"A".join(["Bob"]*100))',
+ "join list of 100 words, with 1 character sep", 1000)
+def join_100_words_single(STR):
+ sep = STR("A")
+ s2 = [STR("Bob")]*100
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+ at bench('"ABCDE".join(["Bob"]*100))',
+ "join list of 100 words, with 5 character sep", 1000)
+def join_100_words_5(STR):
+ sep = STR("ABCDE")
+ s2 = [STR("Bob")]*100
+ sep_join = sep.join
+ for x in _RANGE_1000:
+ sep_join(s2)
+
+#### split tests
+
+ at bench('("Here are some words. "*2).split()', "split whitespace (small)", 1000)
+def whitespace_split(STR):
+ s = STR("Here are some words. "*2)
+ s_split = s.split
+ for x in _RANGE_1000:
+ s_split()
+
+ at bench('("Here are some words. "*2).rsplit()', "split whitespace (small)", 1000)
+def whitespace_rsplit(STR):
+ s = STR("Here are some words. "*2)
+ s_rsplit = s.rsplit
+ for x in _RANGE_1000:
+ s_rsplit()
+
+ at bench('("Here are some words. "*2).split(None, 1)',
+ "split 1 whitespace", 1000)
+def whitespace_split_1(STR):
+ s = STR("Here are some words. "*2)
+ s_split = s.split
+ N = None
+ for x in _RANGE_1000:
+ s_split(N, 1)
+
+ at bench('("Here are some words. "*2).rsplit(None, 1)',
+ "split 1 whitespace", 1000)
+def whitespace_rsplit_1(STR):
+ s = STR("Here are some words. "*2)
+ s_rsplit = s.rsplit
+ N = None
+ for x in _RANGE_1000:
+ s_rsplit(N, 1)
+
+human_text = """\
+Python is a dynamic object-oriented programming language that can be
+used for many kinds of software development. It offers strong support
+for integration with other languages and tools, comes with extensive
+standard libraries, and can be learned in a few days. Many Python
+programmers report substantial productivity gains and feel the language
+encourages the development of higher quality, more maintainable code.
+
+Python runs on Windows, Linux/Unix, Mac OS X, OS/2, Amiga, Palm
+Handhelds, and Nokia mobile phones. Python has also been ported to the
+Java and .NET virtual machines.
+
+Python is distributed under an OSI-approved open source license that
+makes it free to use, even for commercial products.
+"""*25
+human_text_unicode = unicode(human_text)
+def _get_human_text(STR):
+ if STR is unicode:
+ return human_text_unicode
+ if STR is str:
+ return human_text
+ raise AssertionError
+
+ at bench('human_text.split()', "split whitespace (huge)", 10)
+def whitespace_split_huge(STR):
+ s = _get_human_text(STR)
+ s_split = s.split
+ for x in _RANGE_10:
+ s_split()
+
+ at bench('human_text.rsplit()', "split whitespace (huge)", 10)
+def whitespace_rsplit_huge(STR):
+ s = _get_human_text(STR)
+ s_rsplit = s.rsplit
+ for x in _RANGE_10:
+ s_rsplit()
+
+
+
+ at bench('"this\\nis\\na\\ntest\\n".split("\\n")', "split newlines", 1000)
+def newlines_split(STR):
+ s = STR("this\nis\na\ntest\n")
+ s_split = s.split
+ for x in _RANGE_1000:
+ s_split("\n")
+
+
+ at bench('"this\\nis\\na\\ntest\\n".rsplit("\\n")', "split newlines", 1000)
+def newlines_rsplit(STR):
+ s = STR("this\nis\na\ntest\n")
+ s_rsplit = s.rsplit
+ for x in _RANGE_1000:
+ s_rsplit("\n")
+
+ at bench('"this\\nis\\na\\ntest\\n".splitlines()', "split newlines", 1000)
+def newlines_splitlines(STR):
+ s = STR("this\nis\na\ntest\n")
+ s_splitlines = s.splitlines
+ for x in _RANGE_1000:
+ s_splitlines()
+
+## split text with 2000 newlines
+
+def _make_2000_lines():
+ import random
+ r = random.Random(100)
+ chars = map(chr, range(32, 128))
+ i = 0
+ while i < len(chars):
+ chars[i] = " "
+ i += r.randrange(9)
+ s = "".join(chars)
+ s = s*4
+ words = []
+ for i in range(2000):
+ start = r.randrange(96)
+ n = r.randint(5, 65)
+ words.append(s[start:start+n])
+ return "\n".join(words)+"\n"
+
+_text_with_2000_lines = _make_2000_lines()
+_text_with_2000_lines_unicode = unicode(_text_with_2000_lines)
+def _get_2000_lines(STR):
+ if STR is unicode:
+ return _text_with_2000_lines_unicode
+ if STR is str:
+ return _text_with_2000_lines
+ raise AssertionError
+
+
+ at bench('"...text...".split("\\n")', "split 2000 newlines", 10)
+def newlines_split_2000(STR):
+ s = _get_2000_lines(STR)
+ s_split = s.split
+ for x in _RANGE_10:
+ s_split("\n")
+
+ at bench('"...text...".rsplit("\\n")', "split 2000 newlines", 10)
+def newlines_rsplit_2000(STR):
+ s = _get_2000_lines(STR)
+ s_rsplit = s.rsplit
+ for x in _RANGE_10:
+ s_rsplit("\n")
+
+ at bench('"...text...".splitlines()', "split 2000 newlines", 10)
+def newlines_splitlines_2000(STR):
+ s = _get_2000_lines(STR)
+ s_splitlines = s.splitlines
+ for x in _RANGE_10:
+ s_splitlines()
+
+
+## split text on "--" characters
+ at bench(
+ '"this--is--a--test--of--the--emergency--broadcast--system".split("--")',
+ "split on multicharacter separator (small)", 1000)
+def split_multichar_sep_small(STR):
+ s = STR("this--is--a--test--of--the--emergency--broadcast--system")
+ s_split = s.split
+ for x in _RANGE_1000:
+ s_split("--")
+ at bench(
+ '"this--is--a--test--of--the--emergency--broadcast--system".rsplit("--")',
+ "split on multicharacter separator (small)", 1000)
+def rsplit_multichar_sep_small(STR):
+ s = STR("this--is--a--test--of--the--emergency--broadcast--system")
+ s_rsplit = s.rsplit
+ for x in _RANGE_1000:
+ s_rsplit("--")
+
+## split dna text on "ACTAT" characters
+ at bench('dna.split("ACTAT")',
+ "split on multicharacter separator (dna)", 10)
+def split_multichar_sep_dna(STR):
+ s = _get_dna(STR)
+ s_split = s.split
+ for x in _RANGE_10:
+ s_split("ACTAT")
+
+ at bench('dna.rsplit("ACTAT")',
+ "split on multicharacter separator (dna)", 10)
+def rsplit_multichar_sep_dna(STR):
+ s = _get_dna(STR)
+ s_rsplit = s.rsplit
+ for x in _RANGE_10:
+ s_rsplit("ACTAT")
+
+
+
+## split with limits
+
+GFF3_example = "\t".join([
+ "I", "Genomic_canonical", "region", "357208", "396183", ".", "+", ".",
+ "ID=Sequence:R119;note=Clone R119%3B Genbank AF063007;Name=R119"])
+
+ at bench('GFF3_example.split("\\t")', "tab split", 1000)
+def tab_split_no_limit(STR):
+ s = STR(GFF3_example)
+ s_split = s.split
+ for x in _RANGE_1000:
+ s_split("\t")
+
+ at bench('GFF3_example.split("\\t", 8)', "tab split", 1000)
+def tab_split_limit(STR):
+ s = STR(GFF3_example)
+ s_split = s.split
+ for x in _RANGE_1000:
+ s_split("\t", 8)
+
+ at bench('GFF3_example.rsplit("\\t")', "tab split", 1000)
+def tab_rsplit_no_limit(STR):
+ s = STR(GFF3_example)
+ s_rsplit = s.rsplit
+ for x in _RANGE_1000:
+ s_rsplit("\t")
+
+ at bench('GFF3_example.rsplit("\\t", 8)', "tab split", 1000)
+def tab_rsplit_limit(STR):
+ s = STR(GFF3_example)
+ s_rsplit = s.rsplit
+ for x in _RANGE_1000:
+ s_rsplit("\t", 8)
+
+#### Count characters
+
+ at bench('...text.with.2000.newlines.count("\\n")',
+ "count newlines", 10)
+def count_newlines(STR):
+ s = _get_2000_lines(STR)
+ s_count = s.count
+ for x in _RANGE_10:
+ s_count("\n")
+
+# Orchid sequences concatenated, from Biopython
+_dna = """
+CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGGGTT
+AATCTGGAGGATCTGTTTACTTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGAATTGCCATCG
+AGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGCAGTTTTGCTCCAAGTCGTT
+TGACACATAATTGGTGAAGGGGGTGGCATCCTTCCCTGACCCTCCCCCAACTATTTTTTTAACAACTCTC
+AGCAACGGAGACTCAGTCTTCGGCAAATGCGATAAATGGTGTGAATTGCAGAATCCCGTGCACCATCGAG
+TCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCATTGCGAGTCATAT
+CTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCGGATGTGAGTTTGGCCCCTTGTTCTT
+TGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAGGTGGACGAACTAT
+GCTACAACAAAATTGTTGTGCAGAGGCCCCGGGTTGTCGTATTAGATGGGCCACCGTAATCTGAAGACCC
+TTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGCGACCCCAGGTCAG
+GTGAGCAACAGCTGTCGTAACAAGGTTTCCGTAGGGTGAACTGCGGAAGGATCATTGTTGAGATCACATA
+ATAATTGATCGAGTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGAC
+CTAGATTTGCCATCGAGCCTCCTTGGGAGCATCCTTGTTGGCGATATCTAAACCCTCAATTTTTCCCCCA
+ATCAAATTACACAAAATTGGTGGAGGGGGTGGCATTCTTCCCTTACCCTCCCCCAAATATTTTTTTAACA
+ACTCTCAGCAACGGATATCTCAGCTCTTGCATCGATGAAGAACCCACCGAAATGCGATAAATGGTGTGAA
+TTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACG
+CCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCAGCCGGTGCG
+GATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGATGCATGGGCTTTTGATGGTCCTAA
+ATACGGCAAGAGGTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATAAG
+ATGGGCCACCGATATCTGAAGACCCTTTTGGACCCCATTGGAGCCCATCAACCCATGTCAGTTGATGGCC
+ATTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGA
+GTTAATCTGGAGGATCTGTTTACTTGGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCA
+TCGAGCCTCCTTGGGAGCTTTCTTGTTGGCGATATCTAAACCCTTGCCCGGCAGAGTTTTGGGAATCCCG
+TGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCTGCCTGGGCAT
+TGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACACACCTGTTCAGCCGGTGCGGATGTGAGTTTG
+GCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCTTTTGATGGTCCTAAATACGGCAAGAG
+GTGGACGAACTATGCTACAACAAAATTGTTGTGCAAAGGCCCCGGGTTGTCGTATTAGATGGGCCACCAT
+AATCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGGCCATTTGGTTGC
+GACCCAGTCAGGTGAGGGTAGGTGAACCTGCGGAAGGATCATTGTTGAGATCACATAATAATTGATCGAG
+TTAATCTGGAGGATCTGTTTACTTTGGTCACCCATGGGCATTTGCTGTTGAAGTGACCTAGATTTGCCAT
+CGAGCCTCCTTGGGAGCTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTTGGCGCCAAGTCA
+TATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAACAACTC
+TCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGAATTGC
+AGAATCCCGTGAACCATCGAGTCTTTGGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCACGCCT
+GCCTGGGCATTGGGAATCATATCTCTCCCCTAACGAGGCTATCCAAACATACTGTTCATCCGGTGCGGAT
+GTGAGTTTGGCCCCTTGTTCTTTGGTACCGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTCAAAA
+CGGCAAGAGGTGGACGAACTATGCCACAACAAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTAGATG
+GGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATGACCA
+TTTGTTGCGACCCCAGTCAGCTGAGCAACCCGCTGAGTGGAAGGTCATTGCCGATATCACATAATAATTG
+ATCGAGTTAATCTGGAGGATCTGTTTACTTGGTCACCCATGAGCATTTGCTGTTGAAGTGACCTAGATTT
+GCCATCGAGCCTCCTTGGGAGTTTTCTTGTTGGCGAGATCTAAACCCTTGCCCGGCGGAGTTGTGCGCCA
+AGTCATATGACACATAATTGGTGAAGGGGGTGGCATCCTGCCCTGACCCTCCCCAAATTATTTTTTTAAC
+AACTCTCAGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGCAGCGAAATGCGATAAATGGTGTGA
+ATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAGGCCATCAGGCCAAGGGCAC
+GCCTGCCTGGGCATTGCGAGTCATATCTCTCCCTTAACGAGGCTGTCCATACATACTGTTCATCCGGTGC
+GGATGTGAGTTTGGCCCCTTGTTCTTTGGTACGGGGGGTCTAAGAGCTGCATGGGCATTTGATGGTCCTC
+AAAACGGCAAGAGGTGGACGAACTATGCTACAACCAAATTGTTGTCCCAAGGCCCCGGGTTGTCGTATTA
+GATGGGCCACCGTAACCTGAAGACCCTTTTGAACCCCATTGGAGGCCCATCAACCCATGATCAGTTGATG
+ACCATGTGTTGCGACCCCAGTCAGCTGAGCAACGCGCTGAGCGTAACAAGGTTTCCGTAGGTGGACCTCC
+GGGAGGATCATTGTTGAGATCACATAATAATTGATCGAGGTAATCTGGAGGATCTGCATATTTTGGTCAC
+"""
+_dna = "".join(_dna.splitlines())
+_dna = _dna * 25
+_dna_unicode = unicode(_dna)
+
+def _get_dna(STR):
+ if STR is unicode:
+ return _dna_unicode
+ if STR is str:
+ return _dna
+ raise AssertionError
+
+ at bench('dna.count("AACT")', "count AACT substrings in DNA example", 10)
+def count_aact(STR):
+ seq = _get_dna(STR)
+ seq_count = seq.count
+ for x in _RANGE_10:
+ seq_count("AACT")
+
+##### startswith and endswith
+
+ at bench('"Andrew".startswith("A")', 'startswith single character', 1000)
+def startswith_single(STR):
+ s1 = STR("Andrew")
+ s2 = STR("A")
+ s1_startswith = s1.startswith
+ for x in _RANGE_1000:
+ s1_startswith(s2)
+
+ at bench('"Andrew".startswith("Andrew")', 'startswith multiple characters',
+ 1000)
+def startswith_multiple(STR):
+ s1 = STR("Andrew")
+ s2 = STR("Andrew")
+ s1_startswith = s1.startswith
+ for x in _RANGE_1000:
+ s1_startswith(s2)
+
+ at bench('"Andrew".startswith("Anders")',
+ 'startswith multiple characters - not!', 1000)
+def startswith_multiple_not(STR):
+ s1 = STR("Andrew")
+ s2 = STR("Anders")
+ s1_startswith = s1.startswith
+ for x in _RANGE_1000:
+ s1_startswith(s2)
+
+
+# endswith
+
+ at bench('"Andrew".endswith("w")', 'endswith single character', 1000)
+def endswith_single(STR):
+ s1 = STR("Andrew")
+ s2 = STR("w")
+ s1_endswith = s1.endswith
+ for x in _RANGE_1000:
+ s1_endswith(s2)
+
+ at bench('"Andrew".endswith("Andrew")', 'endswith multiple characters', 1000)
+def endswith_multiple(STR):
+ s1 = STR("Andrew")
+ s2 = STR("Andrew")
+ s1_endswith = s1.endswith
+ for x in _RANGE_1000:
+ s1_endswith(s2)
+
+ at bench('"Andrew".endswith("Anders")',
+ 'endswith multiple characters - not!', 1000)
+def endswith_multiple_not(STR):
+ s1 = STR("Andrew")
+ s2 = STR("Anders")
+ s1_endswith = s1.endswith
+ for x in _RANGE_1000:
+ s1_endswith(s2)
+
+#### Strip
+
+ at bench('"Hello!\\n".strip()', 'strip terminal newline', 1000)
+def terminal_newline_strip_right(STR):
+ s = STR("Hello!\n")
+ s_strip = s.strip
+ for x in _RANGE_1000:
+ s_strip()
+
+ at bench('"Hello!\\n".rstrip()', 'strip terminal newline', 1000)
+def terminal_newline_rstrip(STR):
+ s = STR("Hello!\n")
+ s_rstrip = s.rstrip
+ for x in _RANGE_1000:
+ s_rstrip()
+
+ at bench('"\\nHello!".strip()', 'strip terminal newline', 1000)
+def terminal_newline_strip_left(STR):
+ s = STR("\nHello!")
+ s_strip = s.strip
+ for x in _RANGE_1000:
+ s_strip()
+
+ at bench('"\\nHello!\\n".strip()', 'strip terminal newline', 1000)
+def terminal_newline_strip_both(STR):
+ s = STR("\nHello!\n")
+ s_strip = s.strip
+ for x in _RANGE_1000:
+ s_strip()
+
+ at bench('"\\nHello!".rstrip()', 'strip terminal newline', 1000)
+def terminal_newline_lstrip(STR):
+ s = STR("\nHello!")
+ s_lstrip = s.lstrip
+ for x in _RANGE_1000:
+ s_lstrip()
+
+# Strip multiple spaces or tabs
+
+ at bench('"Hello\\t \\t".strip()', 'strip terminal spaces and tabs', 1000)
+def terminal_space_strip(STR):
+ s = STR("Hello\t \t!")
+ s_strip = s.strip
+ for x in _RANGE_1000:
+ s_strip()
+
+ at bench('"Hello\\t \\t".rstrip()', 'strip terminal spaces and tabs', 1000)
+def terminal_space_rstrip(STR):
+ s = STR("Hello!\t \t")
+ s_rstrip = s.rstrip
+ for x in _RANGE_1000:
+ s_rstrip()
+
+ at bench('"\\t \\tHello".rstrip()', 'strip terminal spaces and tabs', 1000)
+def terminal_space_lstrip(STR):
+ s = STR("\t \tHello!")
+ s_lstrip = s.lstrip
+ for x in _RANGE_1000:
+ s_lstrip()
+
+
+#### replace
+ at bench('"This is a test".replace(" ", "\\t")', 'replace single character',
+ 1000)
+def replace_single_character(STR):
+ s = STR("This is a test!")
+ from_str = STR(" ")
+ to_str = STR("\t")
+ s_replace = s.replace
+ for x in _RANGE_1000:
+ s_replace(from_str, to_str)
+
+ at uses_re
+ at bench('re.sub(" ", "\\t", "This is a test"', 'replace single character',
+ 1000)
+def replace_single_character_re(STR):
+ s = STR("This is a test!")
+ pat = re.compile(STR(" "))
+ to_str = STR("\t")
+ pat_sub = pat.sub
+ for x in _RANGE_1000:
+ pat_sub(to_str, s)
+
+ at bench('"...text.with.2000.lines...replace("\\n", " ")',
+ 'replace single character, big string', 10)
+def replace_single_character_big(STR):
+ s = _get_2000_lines(STR)
+ from_str = STR("\n")
+ to_str = STR(" ")
+ s_replace = s.replace
+ for x in _RANGE_10:
+ s_replace(from_str, to_str)
+
+ at uses_re
+ at bench('re.sub("\\n", " ", "...text.with.2000.lines...")',
+ 'replace single character, big string', 10)
+def replace_single_character_big_re(STR):
+ s = _get_2000_lines(STR)
+ pat = re.compile(STR("\n"))
+ to_str = STR(" ")
+ pat_sub = pat.sub
+ for x in _RANGE_10:
+ pat_sub(to_str, s)
+
+
+ at bench('dna.replace("ATC", "ATT")',
+ 'replace multiple characters, dna', 10)
+def replace_multiple_characters_dna(STR):
+ seq = _get_dna(STR)
+ from_str = STR("ATC")
+ to_str = STR("ATT")
+ seq_replace = seq.replace
+ for x in _RANGE_10:
+ seq_replace(from_str, to_str)
+
+# This increases the character count
+ at bench('"...text.with.2000.newlines...replace("\\n", "\\r\\n")',
+ 'replace and expand multiple characters, big string', 10)
+def replace_multiple_character_big(STR):
+ s = _get_2000_lines(STR)
+ from_str = STR("\n")
+ to_str = STR("\r\n")
+ s_replace = s.replace
+ for x in _RANGE_10:
+ s_replace(from_str, to_str)
+
+
+# This decreases the character count
+ at bench('"When shall we three meet again?".replace("ee", "")',
+ 'replace/remove multiple characters', 1000)
+def replace_multiple_character_remove(STR):
+ s = STR("When shall we three meet again?")
+ from_str = STR("ee")
+ to_str = STR("")
+ s_replace = s.replace
+ for x in _RANGE_1000:
+ s_replace(from_str, to_str)
+
+
+big_s = "A" + ("Z"*128*1024)
+big_s_unicode = unicode(big_s)
+def _get_big_s(STR):
+ if STR is unicode: return big_s_unicode
+ if STR is str: return big_s
+ raise AssertionError
+
+# The older replace implementation counted all matches in
+# the string even when it only neeed to make one replacement.
+ at bench('("A" + ("Z"*128*1024)).replace("A", "BB", 1)',
+ 'quick replace single character match', 10)
+def quick_replace_single_match(STR):
+ s = _get_big_s(STR)
+ from_str = STR("A")
+ to_str = STR("BB")
+ s_replace = s.replace
+ for x in _RANGE_10:
+ s_replace(from_str, to_str, 1)
+
+ at bench('("A" + ("Z"*128*1024)).replace("AZZ", "BBZZ", 1)',
+ 'quick replace multiple character match', 10)
+def quick_replace_multiple_match(STR):
+ s = _get_big_s(STR)
+ from_str = STR("AZZ")
+ to_str = STR("BBZZ")
+ s_replace = s.replace
+ for x in _RANGE_10:
+ s_replace(from_str, to_str, 1)
+
+
+####
+
+# CCP does a lot of this, for internationalisation of ingame messages.
+_format = "The %(thing)s is %(place)s the %(location)s."
+_format_dict = { "thing":"THING", "place":"PLACE", "location":"LOCATION", }
+_format_unicode = unicode(_format)
+_format_dict_unicode = dict([ (unicode(k), unicode(v)) for (k,v) in _format_dict.iteritems() ])
+
+def _get_format(STR):
+ if STR is unicode:
+ return _format_unicode
+ if STR is str:
+ return _format
+ raise AssertionError
+
+def _get_format_dict(STR):
+ if STR is unicode:
+ return _format_dict_unicode
+ if STR is str:
+ return _format_dict
+ raise AssertionError
+
+# Formatting.
+ at bench('"The %(k1)s is %(k2)s the %(k3)s."%{"k1":"x","k2":"y","k3":"z",}',
+ 'formatting a string type with a dict', 1000)
+def format_with_dict(STR):
+ s = _get_format(STR)
+ d = _get_format_dict(STR)
+ for x in _RANGE_1000:
+ s % d
+
+
+#### Upper- and lower- case conversion
+
+ at bench('("Where in the world is Carmen San Deigo?"*10).lower()',
+ "case conversion -- rare", 1000)
+def lower_conversion_rare(STR):
+ s = STR("Where in the world is Carmen San Deigo?"*10)
+ s_lower = s.lower
+ for x in _RANGE_1000:
+ s_lower()
+
+ at bench('("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10).lower()',
+ "case conversion -- dense", 1000)
+def lower_conversion_dense(STR):
+ s = STR("WHERE IN THE WORLD IS CARMEN SAN DEIGO?"*10)
+ s_lower = s.lower
+ for x in _RANGE_1000:
+ s_lower()
+
+
+ at bench('("wHERE IN THE WORLD IS cARMEN sAN dEIGO?"*10).upper()',
+ "case conversion -- rare", 1000)
+def upper_conversion_rare(STR):
+ s = STR("Where in the world is Carmen San Deigo?"*10)
+ s_upper = s.upper
+ for x in _RANGE_1000:
+ s_upper()
+
+ at bench('("where in the world is carmen san deigo?"*10).upper()',
+ "case conversion -- dense", 1000)
+def upper_conversion_dense(STR):
+ s = STR("where in the world is carmen san deigo?"*10)
+ s_upper = s.upper
+ for x in _RANGE_1000:
+ s_upper()
+
+
+# end of benchmarks
+
+#################
+
+class BenchTimer(timeit.Timer):
+ def best(self, repeat=1):
+ for i in range(1, 10):
+ number = 10**i
+ try:
+ x = self.timeit(number)
+ except:
+ self.print_exc()
+ raise
+ if x > 0.2:
+ break
+ times = [x]
+ for i in range(1, repeat):
+ times.append(self.timeit(number))
+ return min(times) / number
+
+def main():
+ (options, test_names) = parser.parse_args()
+ if options.str_only and options.unicode_only:
+ raise SystemExit("Only one of --8-bit and --unicode are allowed")
+
+ bench_functions = []
+ for (k,v) in globals().items():
+ if hasattr(v, "is_bench"):
+ if test_names:
+ for name in test_names:
+ if name in v.group:
+ break
+ else:
+ # Not selected, ignore
+ continue
+ if options.skip_re and hasattr(v, "uses_re"):
+ continue
+
+ bench_functions.append( (v.group, k, v) )
+ bench_functions.sort()
+
+ print "string\tunicode"
+ print "(in ms)\t(in ms)\t%\tcomment"
+
+ str_total = uni_total = 0.0
+
+ for title, group in itertools.groupby(bench_functions,
+ operator.itemgetter(0)):
+ print 'class', title.replace(' ', '_').replace('-', '_') + '_Str', '(Test):'
+ print ' def test(self):'
+ groupList = list(group)
+ for g in groupList:
+ s = repr(g).split('<function ')[1]
+ s = s.split()[0]
+ print ' ', s, '(str)'
+
+ print 'class', title.replace(' ', '_').replace('-', '_') + '_Unicode', '(Test):'
+ print ' def test(self):'
+ for g in groupList:
+ s = repr(g).split('<function ')[1]
+ s = s.split()[0]
+ print ' ', s, '(unicode)'
+ sys.exit(0)
+ for title, group in itertools.groupby(bench_functions,
+ operator.itemgetter(0)):
+ print "="*10, title
+ for (_, k, v) in group:
+ if hasattr(v, "is_bench"):
+ if not options.unicode_only:
+ str_time = BenchTimer("__main__.%s(str)" % (k,),
+ "import __main__").best(REPEAT)
+ else:
+ str_time = 0.0
+ if not options.str_only:
+ uni_time = BenchTimer("__main__.%s(unicode)" % (k,),
+ "import __main__").best(REPEAT)
+ else:
+ uni_time = 0.0
+ try:
+ average = str_time/uni_time
+ except ZeroDivisionError:
+ average = 0.0
+ print "%.2f\t%.2f\t%.1f\t%s (*%d)" % (
+ 1000*str_time, 1000*uni_time, 100.*average,
+ v.comment, v.repeat_count)
+
+ str_total += str_time
+ uni_total += uni_time
+
+ if str_total == uni_total == 0.0:
+ print "That was zippy!"
+ else:
+ try:
+ ratio = str_time/uni_time
+ except ZeroDivisionError:
+ ratio = 0.0
+ print "%.2f\t%.2f\t%.1f\t%s" % (
+ 1000*str_total, 1000*uni_total, 100.*ratio,
+ "TOTAL")
+
+if __name__ == "__main__":
+ main()
+
+
+class Stringbench_Part_1(Test):
+ def test(self):
+ for i in xrange(self.rounds):
+ lower_conversion_dense (str)
+ upper_conversion_dense (str)
+ lower_conversion_dense (unicode)
+ upper_conversion_dense (unicode)
+ lower_conversion_rare (str)
+ upper_conversion_rare (str)
+ lower_conversion_rare (unicode)
+ upper_conversion_rare (unicode)
+ concat_many_strings (str)
+ concat_many_strings (unicode)
+ concat_two_strings (str)
+ concat_two_strings (unicode)
+ count_aact (str)
+ count_aact (unicode)
+ count_newlines (str)
+ count_newlines (unicode)
+class Stringbench_Part_2(Test):
+ def test(self):
+ for i in xrange(self.rounds):
+ find_quick_match_single_character (str)
+ in_test_quick_match_single_character (str)
+ index_test_quick_match_single_character (str)
+ find_quick_match_single_character (unicode)
+ in_test_quick_match_single_character (unicode)
+ index_test_quick_match_single_character (unicode)
+ find_test_quick_match_two_characters (str)
+ in_test_quick_match_two_characters (str)
+ index_test_quick_match_two_characters (str)
+ find_test_quick_match_two_characters (unicode)
+ in_test_quick_match_two_characters (unicode)
+ index_test_quick_match_two_characters (unicode)
+ endswith_multiple (str)
+ endswith_multiple (unicode)
+ endswith_multiple_not (str)
+ endswith_multiple_not (unicode)
+ endswith_single (str)
+ endswith_single (unicode)
+ format_with_dict (str)
+ format_with_dict (unicode)
+ join_empty_single (str)
+ join_empty_single (unicode)
+ join_empty_5 (str)
+ join_empty_5 (unicode)
+ join_100_words_single (str)
+ join_100_words_single (unicode)
+ join_100_words_5 (str)
+ join_100_words_5 (unicode)
+ join_alphabet_list_single (str)
+ join_alphabet_list_single (unicode)
+ join_alphabet_list_five (str)
+ join_alphabet_list_five (unicode)
+ join_alphabet_single (str)
+ join_alphabet_single (unicode)
+ join_alphabet_5 (str)
+ join_alphabet_5 (unicode)
+class Stringbench_Part_3(Test):
+ def test(self):
+ for i in xrange(self.rounds):
+ find_test_slow_match_100_characters (str)
+ in_test_slow_match_100_characters (str)
+ index_test_slow_match_100_characters (str)
+ find_test_slow_match_100_characters (unicode)
+ in_test_slow_match_100_characters (unicode)
+ index_test_slow_match_100_characters (unicode)
+ find_test_slow_match_two_characters (str)
+ in_test_slow_match_two_characters (str)
+ index_test_slow_match_two_characters (str)
+ find_test_slow_match_two_characters (unicode)
+ in_test_slow_match_two_characters (unicode)
+class Stringbench_Part_4(Test):
+ def test(self):
+ for i in xrange(self.rounds):
+ index_test_slow_match_two_characters (unicode)
+ find_test_no_match_single_character (str)
+ in_test_no_match_single_character (str)
+ find_test_no_match_single_character (unicode)
+ in_test_no_match_single_character (unicode)
+ find_test_no_match_two_character (str)
+ in_test_no_match_two_character (str)
+ find_test_no_match_two_character (unicode)
+ in_test_no_match_two_character (unicode)
+ quick_replace_multiple_match (str)
+ quick_replace_multiple_match (unicode)
+ quick_replace_single_match (str)
+ quick_replace_single_match (unicode)
+ repeat_single_10_times (str)
+ repeat_single_10_times (unicode)
+ repeat_single_1000_times (str)
+ repeat_single_1000_times (unicode)
+ repeat_5_10_times (str)
+ repeat_5_10_times (unicode)
+ repeat_5_1000_times (str)
+ repeat_5_1000_times (unicode)
+ replace_multiple_character_big (str)
+ replace_multiple_character_big (unicode)
+ replace_multiple_characters_dna (str)
+ replace_multiple_characters_dna (unicode)
+ replace_single_character (str)
+ replace_single_character (unicode)
+ replace_single_character_big (str)
+ replace_single_character_big (unicode)
+ replace_multiple_character_remove (str)
+ replace_multiple_character_remove (unicode)
+ whitespace_rsplit_1 (str)
+ whitespace_split_1 (str)
+ whitespace_rsplit_1 (unicode)
+ whitespace_split_1 (unicode)
+ newlines_rsplit_2000 (str)
+ newlines_split_2000 (str)
+ newlines_splitlines_2000 (str)
+ newlines_rsplit_2000 (unicode)
+ newlines_split_2000 (unicode)
+ newlines_splitlines_2000 (unicode)
+ newlines_rsplit (str)
+ newlines_split (str)
+ newlines_splitlines (str)
+ newlines_rsplit (unicode)
+ newlines_split (unicode)
+ newlines_splitlines (unicode)
+ rsplit_multichar_sep_dna (str)
+ split_multichar_sep_dna (str)
+ rsplit_multichar_sep_dna (unicode)
+ split_multichar_sep_dna (unicode)
+ rsplit_multichar_sep_small (str)
+ split_multichar_sep_small (str)
+ rsplit_multichar_sep_small (unicode)
+ split_multichar_sep_small (unicode)
+class Stringbench_Part_5(Test):
+ def test(self):
+ for i in xrange(self.rounds):
+ whitespace_rsplit_huge (str)
+ whitespace_split_huge (str)
+ whitespace_rsplit_huge (unicode)
+ whitespace_split_huge (unicode)
+ whitespace_rsplit (str)
+ whitespace_split (str)
+ whitespace_rsplit (unicode)
+ whitespace_split (unicode)
+ startswith_multiple (str)
+ startswith_multiple (unicode)
+ startswith_multiple_not (str)
+ startswith_multiple_not (unicode)
+ startswith_single (str)
+ startswith_single (unicode)
+ terminal_newline_lstrip (str)
+ terminal_newline_rstrip (str)
+ terminal_newline_strip_both (str)
+ terminal_newline_strip_left (str)
+ terminal_newline_strip_right (str)
+ terminal_newline_lstrip (unicode)
+ terminal_newline_rstrip (unicode)
+ terminal_newline_strip_both (unicode)
+ terminal_newline_strip_left (unicode)
+ terminal_newline_strip_right (unicode)
+ terminal_space_lstrip (str)
+ terminal_space_rstrip (str)
+ terminal_space_strip (str)
+ terminal_space_lstrip (unicode)
+ terminal_space_rstrip (unicode)
+ terminal_space_strip (unicode)
+ tab_rsplit_limit (str)
+ tab_rsplit_no_limit (str)
+ tab_split_limit (str)
+ tab_split_no_limit (str)
+ tab_rsplit_limit (unicode)
+ tab_rsplit_no_limit (unicode)
+ tab_split_limit (unicode)
+ tab_split_no_limit (unicode)


More information about the Python-checkins mailing list

AltStyle によって変換されたページ (->オリジナル) /