Commit ec03cc0

committed

D. J.:

- Added the leetcode problem and solution for 187

1 parent e3313df commit ec03cc0Copy full SHA for ec03cc0

File tree

+43

-0

lines changed

+43

-0

lines changed

Lines changed: 1 addition & 0 deletions

Original file line number	Diff line number	Diff line change
`@@ -182,6 +182,7 @@`
`182`	`182`	`- [169 Majority Element](https://leetcode.com/problems/majority-element/description/)`
`183`	`183`	`- [172 Factorial Trailing Zeroes](https://leetcode.com/problems/factorial-trailing-zeroes/description/)`
`184`	`184`	`- [173 Binary Search Tree Iterator](https://leetcode.com/problems/binary-search-tree-iterator/description/)`
	`185`	`+- [187 Repeated DNA Sequences](https://leetcode.com/problems/repeated-dna-sequences/description/)`
`185`	`186`	`- [188 Best Time to Buy and Sell Stock IV](https://leetcode.com/problems/best-time-to-buy-and-sell-stock-iv/description/)`
`186`	`187`	`- [189 Rotate Array](https://leetcode.com/problems/rotate-array/description/)`
`187`	`188`	`- [190 Reverse Bits](https://leetcode.com/problems/reverse-bits/description/)`

Lines changed: 24 additions & 0 deletions

Original file line number	Diff line number	Diff line change
`@@ -0,0 +1,24 @@`
	`1`	`+import collections`
	`2`	`+from typing import List`
	`3`	`+`
	`4`	`+`
	`5`	`+class Solution:`
	`6`	`+ """Base class for all LeetCode Problems."""`
	`7`	`+`
	`8`	`+ def findRepeatedDnaSequences(self, s: str) -> List[str]:`
	`9`	`+ """`
	`10`	`+ The DNA sequence is composed of a series of nucleotides abbreviated`
	`11`	`+ as 'A', 'C', 'G', and 'T'.`
	`12`	`+`
	`13`	`+ For example, "ACGAATTCCG" is a DNA sequence.`
	`14`	`+ When studying DNA, it is useful to identify repeated sequences within the DNA.`
	`15`	`+`
	`16`	`+ Given a string s that represents a DNA sequence, return all the 10-letter-long`
	`17`	`+ sequences (substrings) that occur more than once in a DNA molecule. You may`
	`18`	`+ return the answer in any order.`
	`19`	`+ """`
	`20`	`+ count = collections.defaultdict(int)`
	`21`	`+ for i in range(len(s) - 9):`
	`22`	`+ sequence = s[i : i + 10]`
	`23`	`+ count[sequence] += 1`
	`24`	`+ return list(filter(lambda key: count[key] >= 2, count.keys()))`

Lines changed: 18 additions & 0 deletions

Original file line number	Diff line number	Diff line change
`@@ -0,0 +1,18 @@`
	`1`	`+from typing import List`
	`2`	`+`
	`3`	`+import pytest`
	`4`	`+`
	`5`	`+from awesome_python_leetcode._187_repeated_dna_sequences import Solution`
	`6`	`+`
	`7`	`+`
	`8`	`+@pytest.mark.parametrize(`
	`9`	`+ argnames=["s", "expected"],`
	`10`	`+ argvalues=[`
	`11`	`+ ("AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT", ["AAAAACCCCC", "CCCCCAAAAA"]),`
	`12`	`+ ("AAAAAAAAAAAAA", ["AAAAAAAAAA"]),`
	`13`	`+ ],`
	`14`	`+)`
	`15`	`+def test_func(s: str, expected: List[str]):`
	`16`	`+ """Tests the solution of a LeetCode problem."""`
	`17`	`+ dna_sequences = Solution().findRepeatedDnaSequences(s)`
	`18`	`+ assert dna_sequences == expected`

Comments

(0)