denatured alcohol

(redirected from Denaturat)
Also found in: Thesaurus, Medical, Encyclopedia.

de·na·tured alcohol

(dē-nā′chərd)
n.
Ethyl alcohol to which a poisonous substance, such as acetone or methanol, has been added to make it unfit for consumption.
American Heritage® Dictionary of the English Language, Fifth Edition. Copyright © 2016 by Houghton Mifflin Harcourt Publishing Company. Published by Houghton Mifflin Harcourt Publishing Company. All rights reserved.

denatured alcohol

n
(Chemistry) chem ethanol rendered unfit for human consumption by the addition of a noxious substance, as in methylated spirits
Collins English Dictionary – Complete and Unabridged, 12th Edition 2014 © HarperCollins Publishers 1991, 1994, 1998, 2000, 2003, 2006, 2007, 2009, 2011, 2014
ThesaurusAntonymsRelated WordsSynonymsLegend:
Noun 1. denatured alcohol - ethyl alcohol that is unfit for drinking but is still useful for other purposes
ethanol, ethyl alcohol, fermentation alcohol, grain alcohol - the intoxicating agent in fermented and distilled liquors; used pure or denatured as a solvent or in medicines and colognes and cleaning solutions and rocket fuel; proposed as a renewable clean-burning additive to gasoline
methylated spirit - ethyl alcohol denatured with methyl alcohol to prevent its use as an alcoholic beverage
Based on WordNet 3.0, Farlex clipart collection. © 2003-2012 Princeton University, Farlex Inc.
References in periodicals archive ?
ovale F GCTGTAGCTAATACTTGCTTTA 827 (curtisi and R TTCACCTCTGACATCTGAATC 827 wallikeri) PCR Program Denaturat AnnealiElongation Genus or Temp, Time, Temp, Time, Temp, species [degrees]C min [degrees]C min [degrees]C Plasmodium 94 1 58 2 72 94 1 58 2 72 P.

Full browser ?